
Od Istre do Boke Kotorske

Od Slavonije do Dalmacije

Od Međimurja do Srijema

Od Zagorja do Sandžaka




Kontakt samo
za marke :


[ Program internet radija “Krugoval” ]


Njemačka knjiga Ministarstva Vanjskih Poslova dokaziva srpske zločine u NDH već 3 dana nakon proglašenja Nezavisne Države Hrvatske!

Šok za crvene domaće i dušmanske balkanske bradate bezpovijesne “istoričare” : ova knjiga Ministarska Vanjskih Poslova dokumentira srpske zločine od 13.4.1941 do listopada 1942 godine.

Dokaziva i činjenicu da su postojale tri formacije zločinaca :

- partizani
- četnici
- četnički partizani

Četnici su već 1941 godine prešli u partizane a ne kako bezpovijeni “istoričari” tvrde tek 1945te godine!

Pročitajte ovu knjigu na njemačkom jeziku i djelomično na hrvatskim
prijevodu [ OVDJE ].

NDH nije nikad kapitulirala pred jugo-srpskim okupatorom i pravno postoji još i danas!

Ovo vam jugo-srpski i bradati “istoričari” taje : Nezavisna Država Hrvatska nije pred okupatorima N.D.H. (partizanima i u partizane preobućenim četnicima) kapitulirala i zato pravno postoji još i danas!

Otkrivamo laž da je Poglavnik dr. Ante Pavelić “prodao” Dalmaciju Talijanima : to je već 1922 godine napravio srpski ministar Pašić u Kraljevini Jugoslaviji!


Srbi dokazivaju sami svoju laž o navodnim broju “srpski žrtava” u NDH!

Jugo-srpske brojke dokazuju tko je zbilja žrtva u II. Svijetskom Ratu : prema popisu 1931 i 1948 je bilo
1.024.000 Srba više a 1.230.000 Hrvata manje!

... U lažima su duge brade!


Genetičari potvrdili : Srbi su genetski Turci!

Srpski genetičari iz Instituta Vinča su biokemijski potvrdili 49% turskog haplotipa HG-2 u genetici Srba!


Srbi ukrali “svoj” grb i dvoglavnog orla od bizantske obitelji Palaiologos!

Otkrivena najveća srpska blamaža : ukrali su od bizantske obitelji Palaiologos grb i dvoglavnog orla a turski sultan Mahmud II. je Srbima dizajnirao njihovu zastavu!

Tko laže taj i krade!


Crnogorci svjedoće kako su Srpkinje uživale 500 godina pod Turcima!

Crnogorci svjedoće kako su Srpkinje uživale skoro 500 godina pod Turcima u prvoj bračnij noći i tako poboljšali genetiku takozvani Srba.


Sandžak u Nezavisnoj Državi Hrvatskoj!

O ovim šute domaći crveni izdajnici, četnički zlotvori a i takozvani "Bošnjaci" : Sandžak je bio na zahtjev Sandžaklija 6 mjeseci dio Nezavisne Države Hrvatske!


Otkrivamo srpsku laž
da na Katedrali u Magdeburgu piše anti-hrvatski natpis!

Srbi i domaći izdajnici tvrde da na katedrali u Magdeburgu (Njemačka) piše “Nek nas Bog čuva od kuge, rata i Hrvata!”.

Kontaktirali smo propovjednika i povijestničara katedrale te crkvenjaka katedrale koji su nam potvrdili tu srpsku laž!


Šrbi ubili 80.000 Židova i jedan dio Roma u Srbiji i prepisali svoje zločine Nezavisnoj Državi Hrvatskoj!

Srbi su Hitleru prvi javili da je Srbija “judenfrei” (oslobođena od Židova) i ubila 80.000 nedužni Židova i jedan dio Roma i kasnije te žrtve prepisala Nezavisnoj Državi Hrvatskoj.

Pročitajte i dokumentacije prešućenog srpskog  antisemitizma :


Trojedna Kraljevina  Hrvatska, Slavonija i Dalmacija je postojala 137 godina duže nego Kraljevina Srbija!

Velikosrpski "istoričari" taje da je Srbija na Berlinskom  kongresu 1878. godine postala samostalna a tek 1882 kraljevina, to znaći 137. godina nakon Trojedne Kraljevine Hrvatske, Slavonije i Dalmacije a još više taje da je Srbija bila vazal Hrvatske!


Prema indijskoj svetoj knjigi Rig-Veda se o Hrvatima znade do
12.700 prije Krista!

Pročitajte sve o velikoj bogici Sarasvati i hrvatske Sarasvati-Ind civilizaciji te rano-hrvatske države [ Hurwurdu ],
[ Hurrwuhe-Mitanni ], [ Urartu ],
[ Huritsko kraljevstvo ], [ Harauvatija ]
i [ Chorasmija ]


Šok za Srbe : Srpski vladari nisu bili Srbi!

Otkrivamo : navodna “srpska” dinastija Nemanjića je sve drugo bila, samo ne “srpska”!


Tko laže taj i krade!

Srbi kradu povijest hrvatski državica unutar Crvene Hrvatske [ DUKLJE ],

Tko je zbilja bio crveni šumski bandit Tito?

Dali je lažni smrad Tito bio Joshua Ambroz Mayer ili Walter Weiss?


Homo Balkanicus Primitivus protiv zdravog razuma

Kako se velike “Hrvatine” bune svake godina protiv slavlja “Helloweena” a neznaju o poganstvu u svojoj kršćanskoj vjeri!


Srbi i Sorbi nemaju ništa zajedno!

Bezpovijesni Srbi su propali u pokušaju ukrasti Sorbima identitet i prisvojiti ga sebi. Genetika, vjera, jezik  i veksilologija dokazivaju da opet lažu!


Muslimanske milicije Nezavisne Države Hrvatske.

Procitajte sve o muslimanskoj miliciji u Foči, Goraždu, Sandžaku, Huskinoj legiji, miliciji Salke Ćatića i miliciji Muhameda Hadžiefendića.


Zašto je Mađarska okupirala Međimurje, Bačku i Baranju od Nezavisne Države Hrvatske?

O ovoj temi domaći crveni izdajnici niti sluge bradati bezpovijesni “istoričara” neznaju ništa!


Ovo vam taje domaće sluge bezpovijesni bradati “istoričara” :
Velikaya Horvatiya u dana
šnjoj Ukrajini, Poljskoj i Českoj!

Jeste čuli za tri hrvatske države “Bijelu Hrvatsku”, “Crvenu Hrvatsku” i “Karpatsku hrvatsku” na tlu današnje Ukrajine, Poljske i Česke?


Srbi odgovorni za
17.000.000 mrtvih u
I. Svijetskom ratu!

Franz Ferdinand je htjeo preurediti dualnu “Austro-Ugarsku” monarhiju u trialnu “Austo-Ugarsku-Hrvatsku” pa je balkanski četnički divljak Gavrilo Prinicp dobio nalog da ga ubije.


Srpkinja Sonja Biserko : “Cijela srpska povijest je laž!”

Sonja Biserko, predsjednica Helsinškog odbora Srbije potvrdila otovrenu tajnu : cijela srpska povijest je laž!

U lažima su duge brade!


Hrvatski Muslimani

“Bošnjaci” su Hrvati muslimanske vjere!

Genetika je potvrdila što su hrvatski Muslimani iz Bosne i Sandžaka uvijek znali ali u 90tim godinama prošleg stojeća zaboravili : oni su genetski Hrvati!


Srpski genocid nad Hrvatima :

I prva i druga Jugoslavija su bile tamnica i grobnica za Hrvate – a to domaće crvene izdajice ignoriraju.


Genetika Hrvata :

Za Hrvate se znade prema indijskoj svetoj knjigi “Rig-Veda” čak 12.700 prije Krista a sa takozvane Srbe jedva 1.000 godina. Da su Srbi genetski Turci a da Hrvati nemaju ništa sa Srbima dokaziva i genetika.


Odvratno : Srbi koriste slike Auschwitza za “dokaz” za Jasenovac!

Skandal nad skandalima : jugo-srpski i četničiko-srpski lažovi i mitomani koriste slike Auschwitza i stalinovog terora nad Ukrajincima za navodne ustaške zloćine u radnim logoru Jasenovcu.



Genetika Hrvata :

Dinarokavkaski genom İ/Eu7 (mutacija S31, prije: haplotip I1b1, I. Jurić: hrvatski haplotip), biokemijska formula: M170 - A>C327 tgcttcacacaaatgcgttt / ccaattactttcaacatttaagacc. Haplogrupa İ/Eu7 (S31) je u ljudskoj genetici, haplogrupa muških Y-kromosoma u jugoistočnoj Europi i prednjoj Aziji. Njena veća i naša inačica tj. haplotip I2a2/Eu7 je tipična za naše dinarske i kavkaske etnogrupe, ponajviše kao 1/2 do 3/4 pučanstva za Hrvate, islamske Bošnjake, Crnogorce, kavkaske Swanete, Dargyne i kurdske Delamite (Zazaki), zatim manje oko 1/4 do 1/3 populacije za zapadne Srbe (jekavski Prečani), Moldavce, ine Kurde, Abhaze i Teheran, a rjedje s nižim udjelom za ostale susjedne narode jugoistočne Europe i prednje Azije tj. Starog istoka. Druga manja inačica ili İa1/Eu8 (ranije: I1b2), je u visokom udjelu specifična za otočne starosjedioce na Sardiniji i s manjim udjelima u Baskiji, Italiji, Francuskoj, itd. Nasuprot učestalosti na jugoistoku Europe i u prednjoj Aziji podgrupe I2 i na jugozapadu inačice I2b, varijanta I1 se može najčešće naći kod pučanstva sjeverozapadne Europe, osobito u Švedskoj, Norveškoj, Danskoj, Njemačkoj, Nizozemskoj itd.


Nadgrupa İ/Eu7-8 i podgrupe :

Veliki dio tj. oko 1/4 današnjih Europljana pripadaju široj nadgrupi I/Eu7, koja je jedna je od najvećih haplogrupa u srednjoj i jugoistočnoj Europi te oko Kavkaza. Ova je najčešća i dominantna kod Hrvata pa je bila nazvana hrvatskom ili dinarskom, ali je bila pronađena u visokom postotku i kod Skandinavaca i Nijemaca, a mnogo Sardinaca nosi njenu varijantu s dodatnom mutacijom nazvanu I2b/Eu8. Nositelji I/Eu7 su najvjerojatnije doselili u jugoistočnu Europu iz jugozapadne Azije prije ledenog doba, što znači pred više od 20.000 godina i odatle se proširili po srednoj, sjevernoj i istočnoj Europi. Daljim istraživanjima se otkrilo kako je I/Eu7 razgranata mutacijama u 4 glavna i više manjih podogranaka. Glavne pripadne haplogrupe su: izvorna I*, I1a, I2a i I2b. I1a i c su najbrojnije u izvorno germanskim zemljama a manje u krajevima koje su naselila germanska plemena: Normandija, Engleska i na širem okružju Moskve – možda su ju tamo donesli srednjovjeki Varjagi (Vikinzi) iz Skandinavije. I2a i c su česte kod Kozaka oko ušća Dnjestra.

Korijenska podgrupa I* je nađena raspršeno po cijeloj Europi i prednjoj Aziji s niskim udjelom, osim što je malo više ima u Turskoj i Francuskoj (oko 5%). I1a je značajno prisutna u srednjoj i sjeverozapadnoj Europi i Skandinaviji. Na istom području je najveća koncentracija I1c, ali ona čini manji postotak nego I1a. Naša haplogrupa I2a je najčešća u jugoisočnoj Europi, a ima je dosta još u srednjoj i istočnoj Europi. Među pripadnim narodima je ima jednako ili više od I*, I1a i I1c zajedno. Oko Kavkaza skoro svi Y kromosomi haplogrupe I spadaju u I2a podgrupi. Iz I2 je mutirala podgrupa I2b/Eu8 kojoj pripada većina muškog pučanstva Sardinije odakle se manje proširila na susjedne obale i dalje u zapadnu Europu. Jedino među Baskima I2b se nalazi u malo većem postotku. Haplogrupa I/Eu7 je dijelom karakteristična za Europu i izvan nje je prisutna u većem postotku među Kurdima i na Kavkazu, pa u Turskoj i Iranu. Zanimljivo je da su u Turskoj nađene sve glavne podgrupe uključivo izvornu I*. I1c je nađen sporadično u Pakistanu.

Nadgrupa İ/Eu7-8 obuhvaća europske i prednjoazijske populacije s najvišim udjelom od Skandinavije preko srednje Europe i Balkana do Kavkaza i Teherana. Kako ta nadgrupa većinom obuhvaća nepodobne narode iz europske Osovine u 2. svj. ratu i još u Aziji iz "Osovine zla", to je odnedavna njena genetika izložena raznim kontroverznim postupcima na ime 'političke korektnosti' i inih neznanstvenih interesa. Pripadne populacije se danas ugrubo biokemijski dijele u 2 geografske haplogrupe: sjeverno-germanska İ1 u Skandinaviji i srednjoj Europi, ter naša dinarokavkaska İ2 u jugoistočnoj Europi i prednjoj Aziji. Iako je njihovo razdvajanje najvjerojatnije nastalo u postglacialu, bez sigurnih pokazatelja o tomu se istraživači pobliže ne slažu o vremenu razdvajanja, za koje razni auktori predlažu izmedju 12.000 do 3.000 god. starosti. Naša haplogrupa İ2/Eu7 (P37.2) se pretežno nalazi kod pučanstva jugoistočne Europe i Kavkaza, s najvećom učestalošću osobito u Dalmaciji i u Hercegovini (50 - 73 %). Veliki udjel ove haplogrupe na dinarskom području se možda može objasniti time što je presušeni manji Jadran pri oledbi poslužio kao toplije sklonište za pučanstvo ove podgrupe.

Nama bliska srodna podgrupa İ2b/Eu8 (P41.2 / M359) je najviše nadjena kao dominantna na otoku Sardiniji i još s puno manjim udjelom kod Baska. Više od 40% Sardinaca pripada ovoj grupi. Izumrlo zapadnoeuropsko paleolitsko pučanstvo koje je nosilo haplogrupu İ2b (M26) je moralo preživiti oledbu negdje zapadno od Apenina u južnoj Francuskoj ili zapadnoj Italiji, odakle je pred oko 9.000 godina uspješno naselilo Sardiniju u doba najniže morske razine. Unatoč tomu što je haplogrupa I2b (P41.2=M359) dominantna na Sardiniji, a potječe od dominantno dinarske haplogrupe I2a-P37.2, podgrupe I2b nema istočno od Francuske i Italije iako je s manjim udjelom nađena još u pučanstvu Baleara, Kastilije, Baskije, Pirineja, jugozapadne Francuske, itd. Stoga je ta zapadna podgrupa I2b u bliskoj vezi s jugozapadnim Europljanima paleolitskog iskona i njihovi nosioci imaju tek dalju vezu s dinarskim pučanstvom haplogrupe I2a.

Dinarokavkaska haplogrupa İ2/Eu7 (biokemijska formula: M170 - A>C327 tgcttcacacaaatgcgttt / ccaattactttcaacatttaagacc) se nalazi uglavnom na Balkanu kao i na Kavkazu, a najviše u Hrvatskoj 45% do 66% i u BiH 48 – 73% gdje ima najveću poznatu koncentaciju u Hercegovini (Marjanović i sur. 2005). Kod nas ga ima najviše u Hercegovini, Dalmaciji i istočnoj Slavoniji, a najmanje u Kvarneru i Zagorju, pa tom genomu uglavnom pripada dinarski tip pučanstva BiH, te srednje i južne Hrvatske. Znakovito je kako se Eu7 (M-170) pojavljuje u disjunkciji tj. dalje na istoku izdvojeno u Moldaviji (32 %) i još izvan Europe najviše oko Kavkaza (34-82%), pa u kaspijskom Dagestanu i središnjoj Aziji gdje niz tamošnjih etnogrupa sadrže po 10 - 25% Eu7, što je možda u vezi s dalekim praiskonom ranih pradinaraca (neolitski "Hurrduw").

Ovo je zamalo jedini europski genom čiji posebni jezični ekvivalent dosad još nije jasno odredjen (kod nas je to vjerojatno starodalmatski jezik), ali njihov izvorni jezik sigurno nije slavenski kojemu pripada drugi genetski tip R1a/Eu19. Danas toj haplogrupi u Europi uglavnom pripadaju razne inačice naših ikavaca : ikavski šćakavci, ikavski kajkavci i jadranski čakavci, a izrazito najviši udjel i apsolutnu većinu taj tip dostiže na otocima, npr. na otoku Hvaru gdje ima većinu od 2/3 (66 %), pa 55% na Braču, 54% na Korčuli, 45% na dalmatinskom kopnu i najviše u Hercegovini 73%. Na slično takodjer upućuje poredba grobnih kostura u Dalmaciji i Hercegovini iz antike i srednjeg vijeka koji ne pokazuju slavenske promjene nego uglavnom nastavak dinarskih tipova (Mikić 1976, 1979, 1984), te arheonalazi Komanske kulture u Dalmaciji i Crnoj Gori iz 6.- od Zadra do Skadra, koji još ne pripadaju Slavenima nego starosjediocima (Vinski 1971, Marčinko 2000).


Etnički udjeli İ2/Eu7 :

Dinarokavkaska haplogrupa İ?2/Eu7 (M 170) je manjeviše obilno zastupljena u jugoistočnoj Europi i prednjoj Aziji od Teherana do Slovenije (usp. Semino & al. 2000, Wells & al. 2001, Underhill & al. 2001, Rootsi & al. 2004, Nasidze & al. 2003, 2004, 2005, Jurić 2003-2011) :

- Azijski genski dinarci: najviše kavkaski Swaneti 82% i Dargyni 58%, Abhazi 34%, Teheran 33%, Delamiti (Zazaki) 33%, Oseti 32%, Gagauzi 31%, Andi 27%, Adygejci 25%, Mordvini 19%, Isfahan 17%, Tatari 16%, Taškent 12%, Čuvaši 11 %, Buhara 10%, ini Kurdi 9%, Pakistan 8%, Uzbeki 7%, Udmurti 7%, Karačaji 7%, Nenezi 6%, Fergana 5%, Azeri 5%, Lezgini 5%, Nogajci 5%, Sirijci 5%, Libanon 5%, Armenci 4%, Kazbeki 4%, Marijci 4%, pravi Turci (bez Kurda) 4% - (ini Azijati su ispod 4%) i kod američkih Indianaca 2%.

- Europski genski dinarci: Hercegovina 73%, Dalmacija 56%, sva Hrvatska (prosjek) 46%, slavonski Šokci 42%, Bosna 42%, Crna Gora 38%, Slovenija 38%, Rudanovi  (bez Like i Dalmacije) 34%, Moldavija 32%, Magjarska 28%, Albanija 24%, Kozaci 23%, Rumunji 22%, Makedonci 20%, otok Kreta 18%, Poljaci 18%, Bukovina 18%, Ukrajinci 18%, Andaluzija (jug Španjolske) 14%, sva Grčka (prosjek) 14%, 'Čehoslovaci' 14%, otok Sicilija 12%, Rusi (srednji) 11%, Magjari 11%, Švicarska 8%, Italija (kopno) 7% - (ini Europljani su ispod 7%).


Hrvatski genski dinarci :

Naš dominantni dinarski haplotip İ?2/Eu7 (tj. po novom sinonimu I-M170) kod Hrvata je nazočan prosječno sa 37 - 49%, a nadprosječno iznad 1/2 pučanstva (50-73%) osobito u Hercegovini 73%, Dalmaciji 50-68%, Lici, Kordunu, Banovini i donjoj Posavini (Šokci) 42%. Znakovito je da se osim prednje Azije i najviše Kavkaza (vidi niže), ovaj još manje nalazi (2 %) i kod američkih Indianaca, što upućuje na moguće pradavne kontakte dinaraca i Indianaca. Izrazito najbrojnija haplogrupa Y-kromosoma u Hrvatskoj po svim dosad provedenim studijama je I2. Njen udjel u pučanstvu je od 40-73% tj. 2/5 do 3/4 populacije, ovisno o području i studiji. U drugoj studiji (Peričić et al, 2005) su analizirani Y-kromosomi iz BiH, Srbije, Makedonije i Kosova, ali uz idejno-podobni dio Hrvatske bez neslavenske Like i Dalmacije. Osim među Hrvatima, haplogrupa I2 ima nadpolovičnu većinu među bosanskim Y-kromosomima, oko 1/3 svih Y-kromosoma Srba i Makedonaca i 20% Slovenaca. Kao i u inim studijama, najbrojnija je podgrupa I2a iako je u svim populacijama nazočna i podgrupa I1 tipična za sjevernu u zapadnu Europu. Samo među Hrvatima su nađene sve 4 glavne podgrupe iz I. Zanimljivo je da su na Krku i Braču nazočne uz najveću I2, još i ostale podhaplogrupe u visokom postotku za naše krajeve : 18% na Krku i 17% na Braču. Nažalost taktički nije navedeno o kojim podgrupama se radi. I2a ima takodjer visoki udjel 42% kao dominantna i na sjeveru medju slavonskim Šokcima (I. Jurić 2005, 2007, 2011).


Azijski dinarci İ2/Eu7 :

Iz gornjeg popisa je očevidno kako naš dinarski haplotip İ2/Eu7 uopće nije ograničen samo na Europu, kako to uporno prikrivaju, zaobilaze i prešućuju zamalo svi naši i zapadnjački autori iz idejno-pristranih poriva. Zbog oskudnih istraživanja u Aziji prije 2003. nije bio sigurno potvrdjen izvan Europe, ali po vjerodostojnim analizama Rusa i inih (iz bivšeg SSSRa), on se manjeviše nalazi iznad 5% kod dvadesetak raznih naroda diljem jugozapadne i srednje Azije, a kod nekih oko Kavkaza je podjednako obilan kao kod nas pa nikako nije ograničen u Europi kako neki žele. Ipak već Semino i sur. (2000) i A. Gibbon (2000) ispravno naslućuju da je pripadna naša mutacija M-170 ovamo stigla ranijim selidbama negdje iz “Srednjeg Istoka” (jugozapadne Azije), što su nakon 2001. dosad jasno potvrdili niže navedeni biogenetski nalazi osobito iz Kavkaza (do 58% Eu7), Teherana i Kurdistana (33-34% Eu7), a s manjim udjelom i dalje na istoku sve do Fergane i Pakistana: usp. Weale i sur. 2001, Wells i sur. 2001, Quintana-Murci i sur. 2002, Nasidze i sur. 2004. i 2005, itd.


Kavkaski dinarci :

Dinaridne etnogrupe Kavkaza: Dargyni, Swaneti, Abhazi, Osseti, Adygeji, Karačaji itd. (usp. Ačkasova i sur. 1990, Zerjal i sur. 2002, Nasidze i sur. 2003, 2004, 2005, itd.). Glavni i najizrazitiji biogenetski centar s jasnom i za Aziju najvećom nazočnošću našega dinarskog haplotipa je veliki masiv Kavkaza, gdje ga sadrži cijeli niz desetak raznih reliktnih naroda s arhajskim jezicima. Izrazito najviši udjel našega dinarskog haplotipa tu imaju kavkaski Swaneti čak 82%, Dargyni 58%, Abhazi 33%, Osseti 32%, Adygeji 25% Eu7, pa još Kubani 16%, Karačaji 8%, Lezgini 5% i većina inih susjednih naroda na Kavkazu ispod 5%. Tu je na zapadnokavkaskom području Kubana takodjer nadjen i karirani hrvatski grb na keramičkom skifosu iz II. stoljeća (Ačkasova i sur. 1990). Ove dinaroidne genske etnogrupe zapadnog Kavkaza danas žive na jugoistoku Azovskog mora, tek par desetaka kilometara južnije od antičkog Tanaisa gdje su nadjene 2 antičke ploče s grčkim natpisima našeg etnonima Horouathos (Latyšev 1890).


Dinaridni Kurdi :

Delamiti i Kurmandji (Kandler 1984, Paul 1995, Zerjal i sur. 2001, Al-Zahery i sur. 2003, Cinnioglu i sur. 2004, Nasidze i sur. 2005, Issa-Fatimi i Yoshamya 2009) : Donedavna je genetika Kurda bila skoro nepoznata, ali nam nove analize daju vrlo znakovite pokazatelje za iskon Hrvata. Kod južnih Kurda u Iraku izrazito dominiraju semitski haplotipovi (Eu9 i Eu10), dok je tu naš I2/Eu7 daleko rjedji pa njegov prosjek za Irak iznosi tek 0,7%. Naprotiv spram sjevera njegov udjel medju Kurdima naglo raste, pa je u istočnoj Anatoliji kod najveće kurdske grupe Kurmandji koja obuhvaća blizu polovice svih Kurda, njegov prosjek već iznosi 16%. Dapače, medju sjevernim kurdskim plemenima (Dimili, Zazaki, Kizilbaši) naš I2/Eu7 doseže još veći udjel do 33% tj. skoro kao i kod nas u Hrvatskoj. Ovi sjeverni Kurdi su izvan Europe u Aziji i jezično razmjerno najbliži Hrvatima, čak sa 28% sličnih izoglosa u njihovom rječniku, još uz nazočnost niza naših fonetskih i gramatičkih osobitosti: glasovi “jat”, č, ć, ž itd. (Issa-Fatimi i Yoshamya 2009).

Takodjer i povijesna vrela (Menitsky 1964, Paul 1995) pokazuju nam da ovi sjeverni Kurdi potječu od klasične etnogrupe Delamiti iz pokrajine Dailam na sjeverozapadu Irana i tu je znakovita sličnost s antičkim Delmatima, na čijem je području u Hercegovini i danas najviši europski udjel našeg haplotipa Eu7 čak sa 73%. Inače su Kurdi jedan od najstarijih povijesno dokumentiranih naroda prednje Azije gdje žive još od halkolitske predhistorije, pa ih u prvim klinopisima navode već najraniji Sumerani kao sjeverniju zemlju Karda čak prije 5 milenija, pa Asirci pred 4 tisućljeća kao susjedna gorska plemena Kurki i napokon stari Grci kao planinski narod Kardouchoi (Xenophont god. 394.-371. pr. Kr.). Stoga naš dinarski haplotip u Kurdistanu najvjerojatnije postoji barem kroz 5 tisućljeća pa su odonda jamačno isključene njegove doselidbe iz Europe (što ideološki žele neki iliristi). Zato je povijesno i biogenetski puno vjerojatnija baš obratna selidba iz Kurdistana spram Dalmacije i Hercegovine, koja je bar dijelom povezana s osvajanjima staroperzijskih Ahemenida na Balkanu u pr. Kr. (Ćurić 1991), nakon čega i grčki pomorci po prvi puta navode pleme Delmata u Dalmaciji, gdje su oni tada potisnuli druga starija ilirska plemena.


Iranski dinarci :

Teheran i Iran (usp. Nasidze i sur. 2003, 2004, Qamar i sur. 2002, Quintana-Murci i sur. 2001): Slično Kurdima se naš I2/Eu7 nalazi najviše na sjeverozapadu i sjeveru Irana, a sve manje južnije i na jugoistoku. Tako je npr. u devetmilijunskoj prijestolnici Teheranu nadjena čak 1/3 ili 34% tog tipa, a južnije u Isfahanu 17%. Stoga brojčano u samom Teheranu danas živi više genskih dinaraca negoli kod nas u cijeloj Hrvatskoj, što je paralelno s povijesnim pokazateljima kulturnih sličnosti.


Dinarski Kozaci :

Donski Kozaci (usp. Rootsi i sur. 2004): Na jugoistočnoj granici Europe i Azije, uz donji tijek rijeke Don i oko antičke luke Tanais (kod današnjeg Rostova) žive donski Kozaci kao potomci donedavnih konjaničkih nomada. Takodjer i u njihovom genomu je ondje nadjen naš dinarski haplotip sa 17% I2/Eu7. Dakle je danas Tanais na sjeveru i jugu okružen populacijama u kojima je manjeviše vidljivo nazočan naš dinarski haplotip s udjelom od 17 – 58%. Obzirom da se taj haplotip i sada nalazi uz bivši Tanais i još obilnije južnije uzduž Kavkaza, jedva može biti sumnje da je isti bio manjeviše zastupljen i medju antičkim Sindo-Meotima na istoku Azovskog mora, pa jamačno i kod naše rane etnogrupe Horouathos u samom Tanaisu s kojime tako direktno imamo odnedavna i biogenetsku, a ne samo imensku vezu.


Srednjoazijski dinarci :

Taškent, Buhara i Fergana (Wells i sur. 2001, Zerjal i sur. 2002): Još istočnije od najobilnijeg Kavkaza i Kurdistana, na širjem prostoru stepa i polupustinja u Turkestanu do središnje Azije, tj. u Turkmeniji, Kirgiziji i Tadjikistanu je ta naša dinarska haplogrupa takodjer manjeviše difuzno rasprostranjena većinom u nižim udjelima ispod 15%, što je vjerojatno posljedica prastarih susjedskih primjesa s prahrvatskim pretcima. Npr. u Turkmeniji je za Taškent poznato 12% i za Buharu 10%, a kod još desetak naroda srednje Azije je njegov manji udjel od 4%-5%. Najistočnije dosad poznato nalazište naše dinarokavkaske haplogrupe u središnjoj Aziji je dolina Fergana u gorju Tyan-Shan sa 5% I2/Eu7. Stoga je taj dinarokavkaski haplotip manjeviše raširen na prostranom području šumostepa i polupustinja prednje i srednje Azije, od Kavkaza i Kurdistana sve do Fergane, što upućuje na približna područja ranijih selidbi naših predaka ili bar nama najbližih biogenomskih srodnika.


Indovedski dinarci :

Krajnje najjužnije područje Eurazije, gdje je dinarokavkaska grupa I/Eu7 dosad bolje poznata u značajnom udjelu je sjeverozapadni dio Pakistana (Tribal Area) u graničnom pojasu uz Afganistan (klasična Harauvatya), gdje je kod više plemena nadjeno 7%-16% Eu7 (Qamar i surad. 2002).


Podvale s İ2/Eu7 i R1a/Eu19 od strane veliko-srpskih mitomana, jugo-srpski ostlgika i hrvatski crveni izdajica :

Kad su prve detaljne analize Y-haplogrupa Hrvata od god. 2000-2004. (D. Primorac, M. Marcikić, P. Rudan, I. Jurić i dr.) konačno otkrile kako medju svim jezičnim Slavenima imaju baš Hrvati nedopustivo najmanje (23-27%) 'slavenskog' haplotipa (Dalmacija tek 9-20%) - da se povrh toga još usudimo imati čak osobiti dominantni haplotip İ?2/Eu7 prosječno 37-46% (Dalmacija i Hercegovina čak 60-73%), usljedio je vrlo fanatični protuudar jugoslavista i jugonostalgika, uz logističko-financijsku podršku vanjskih imperialnih mentora koji su podržavali propalu Jugoslaviju i moguću obnovu nove 'Balkanije' i 'Jugosfere'. Prvi imperialni plotun protiv te 'politički nekorektne' genetike nepodobnih Hrvata je ispalio časopis 'Nature' pamfletom s potpisom mikrobiologa dr. M. Radmana kojim se traži prekid i korekcija tih istraživanja (dakako u jugo-smjeru). Zatim su provjerenom metodom (mrkve + batine) obećane znatne potpore za protivna 'istraživanja' i sinekure da se to poništi, što je prihvatio Antropološki institut u Zagrebu i od 2005. su svojim objavama poništili vlastite ranije rezultate kao i inih genetičara.

Taktika te naručene javne podvale je ova: iz tzv. 'hrvatskog' genskog prosjeka su izbačeni i izostavljeni idejno-nepodobni nalazi Like i Dalmacije s premalo slavenskog R1a i previše I2 (tim gorje po činjenice), pa sad politički korektno 'glajhšaltani' novi jugo-Hrvati već imaju podnošljivih 33% R1a + 34% I2: Taj je brainwash od 2005. nadalje javno i uzastopno obznanjen, pa citiran kroz niz časopisa i ponavljan popularnom filmskom emisijom kroz TV. Time Hrvati postaju genetski podobni i prikladni za Jugosferu i Balkaniju, pa Antropološki institut dobiva poveća sredstva i opremu, a organizator prof. P.Rudan postaje akademikom. Doduše, protiv toga javno protestiraju drugi, kao i sveučilišni genetičar prof.dr. Ivan Jurić koji je novim analizama potvrdio i proširio ranije rezultate do 2004. i prokazao krivotvorbe,- ali bez učinka jer "psi laju-karavana prolazi" tj. očite krivotvorbe se uporno nastavljaju u podobno-naručenu geostratešku pseudoznanost. Nakon te uspješne podvale kod nas, slično se s nepodobnom grupom I/Eu7 odnedavna ponavlja i u prednjoj Aziji, gdje je odjednom u novijim američkim analizama "netragom nestala" iz Kavkaza, Kurdistana i Irana,- gdje je već prije obilno nadjena u ruskim, njemačkim i inim izvješćima.


Antropološki odraz İ2/Eu7 :

Narodi s ovom dominantnom nadgrupom (I/Eu7) danas govore raznim jezičnim skupinama, a u Europi pretežno germanski. Morfološki se ističu izrazito vitkim i najvišim rastom od svih Europljana - nadasve Dinarci (I2) i Skandinavci (I1). Kosa im je ravna, pretežno brinet-kestenjasta i oči sivozelene do smedjaste, a brada uža i izbočena. Osobiti oblik razmjerno glomazne lubanje je često specifičan uglato-izdužen poput kutije zaobljenih uglova (tzv. "ćoškaste glave"), dok im je snažan "orlovski" nos razmjerno najveći medju Europljanima. Dinarski starci većinom imaju specifičnu dvodjelnu ćelavost u obliku potkove (tzv. "fratarska tonzura"), gdje rano ćelavljenje počinje bočno iznad oba oka i kružno oko glave, dok u sredini na tjemenu uglavnom preostaje dlakavi otok. Medicinski se nosioci İ2 medju Europljanima najviše ističu kao dugoživi stoljetni metuzalemi (Kavkaz, Sardinija itd.), ali su od inih osjetljiviji na neke bolesti npr. na HIV pa brže stradaju od AIDS-a nego ostali.


Iliri i provale Slavena :

Od 6. stoljeća započinju prodori Slavena preko rimskih provincija i u tom naletu propadaju mnogi gradovi, imanja, utvrde i hramovi. Ugledni rimski historičar Procopius u zapisima iz 550. godine je opisao Slavene kao nevidjene sirove divljake i najveću opasnost po dotadanju civilizaciju, navodeći precizne podatke o svim njihovim pokoljima Ilira i Tračana. Slavenske pljačkaške horde predvodjene Avarima su bile toliko nemilosrdne da je staro domaće pučanstvo bilo prinuđeno prihvatati njihov jezik kako bi bar prividnom asimilacijom privolili avaro-slavenske bande da poštede živote pučanstva. Izrijekom se navodi da je u tim pokoljima pobijeno ili odvedeno u roblje preko 4 milijuna ljudi ili većina tadanjeg pučanstva rimske provincije Dalmacije tj. Ilirije. Od tih čestih slavenskih pokolja autohtonog pučanstva opisan je npr. masakr preko 7.000 žena i djece za samo dva dana 548. godine u gradu Draču (Dyrachion) što navodi Procopius. Naši ideologizirani jugo-istoričari redovito taktički zaobilaze, prešućuju i izostavljaju Prokopija i ine tadanje rimske izvore, pa od 6.- 8. stoljeća lažno tvrde kako im tada navodno "nedostaju istorijski izvori", samo da bi onda uljepšali i uzveličali tobože slavnu i miroljubivu "Veliku Seobu Slavena".

Medjutim,- znanost ipak ide dalje i bar modernim neutralnim i egzaktnim metodama forenzike se jasno dokazuju zamalo sve prozirne obmane, koje su nam silom 'mozgopranja' desetljećima i stoljećima nametnuli raniji okupatori uključivo prije Slavene i novije Jugoslavene. Taj ključni dokaz protiv jugoslavističkih idejnih podvala je danas prvenstveno biokemijska genomika, uz ine suvremene metode koje uglavnom istosmjerno opovrgavaju povijesne podvale zadojenih jugoslavista i sada ponovo materialno-forenzički dokazuju zamalo sve navode Prokopija i onodobnika o koljačkim provalama Slavena (bez stvarne selidbe), - Ove su bile bar podjednake ili još daleko gorje od kasnijih turskih, četničkih i sličnih novijih napada što su doista čisti naivci u poredbi s "romantičnim" Starim Slavenima. Iz toga danas proizlaze 3 ključna rezultata koji nas neizbježno sile na radikalnu reviziju i odbacivanje u ideološku ropotarnicu dosad izmišljene i neistinite "pseudoistorije jugoslavista" :

    1. Kao prvo, u zadnjih desetak godina je više nego jasno i uzastopce potvrdjeno po Y-haplotipu, kako u najvećem dijelu Hrvatske i BiH, a ponajviše u Hercegovini, Liki i Dalmaciji ima čudnovato malo Slavenima sličnog haplotipa Eu19/R1a : u cijeloj Hrvatskoj i Bosni slavenski biogenski tip obuhvaća tek 1/4 do 1/3 pučanstva tj. od 27-35% genskih Slavena medju nama, a samo rubno na sjeverozapadu npr. u Vojvodini, Podravini, Zagorju, Istri, Gorskom Kotaru i Sloveniji je nešto više do polovice genskih Slavena (Semino i sur. 2000, I.Jurić 2003, 2005, 2007, 2011). Dapače, u Hercegovini, Liki i Dalmaciji je udjel neslavensko-dinarskog haplotipa Eu7/I1b još viši oko 1/2 do 3/4 ili od 46-72% pučanstva, a ostalo su razni ini tipovi pa je tu slavenski genski udjel zanemarivo neznatan - ali isti genski neslaveni tu sad govore slavenski. Ovo znači isto što piše Prokopije: bili su nasilno "poslavenjeni". To dalje još znači da u tim dinarskim krajevima zapravo nije bilo tzv. "Velike Seobe Slavena".

    2. Kao drugo i najvažnije je poredbeni omjer muških i ženskih slavenskih gena kod nas, što nam sada dubinski otkriva čak i tip same doselidbe. Kod normalne selidbe naroda, plemena i obitelji je završni omjer muško-ženskih gena bar približno podjednak. Takva se genska ravnoteža kod nas donekle i vidi - ali samo u spomenutim rubnim sjeverozapadnim krajevima i najviše u Sloveniji i Makedoniji gdje su slavenski haplotipovi muškog Y-tipa i ženskih slavenskih mitohondrija podjednako zastupljeni: Ovo znači kako je barem te rubne krajeve izvan Dinarida zahvatila normalna pučka "Selidba Slavena" tj. miroljubivih agrarnih doseljenika. Naprotiv, u većem dijelu Hrvatske je prosječno preko 90% ženskih mitohondrija kod nas neslavenskog iskona, a jedva 6% - 9% ženskih Hrvatica su iskonom Slavenke, što konačno znači da je u Hrvatskoj 3 do 4 puta manje genskih Slavenki od manjinskih muških Slavena. Dapače baš u istim Dinarskim krajevima Like, Hercegovine i Dalmacije slavenske Hrvatice genski umalo ni ne postoje. To stvarno znači upravo ono što piše Prokopije i suvremenici: da su uglavnom muški Slaveni u rimsku Dalmaciju ili Ilirik doista stizali kao razbojničke koljačke horde (bez svojih žena i obitelji), pa su najvjerojatnije tu stvarno pljačkali uz genocidne pokolje i bar tu u Iliriku uglavnom nije ni bilo "Velike Seobe Slavena" s 'miroljubivim' seljacima, kako nas već desetljećima lažno obmanjuju jugoistoričari i naši slavisti.

    3. Treće i ključno je, da u našemu središnjem povijesnom etnoprostoru tj. u Dalmaciji i BiH gdje uglavnom nema slavenskih mitohondrija, naprotiv postoji obilje specifičnih azijatskih mitohondrija koji su najčešći u jugozapadnoj Aziji tj. u bivšemu Perzijskom carstvu. Oni su kod tih središnjih Hrvatica češći negoli igdje u Europi, osim još kod Bugarki i Laponaca. To zapravo znači da u srednjovjeki hrvatski etnoprostor nije doselila samo neka manja vojna elita Iranohrvata, nego cijeli jedan kompletni Iranohrvatski narod sa ženama i djecom. Dakle: krajem antike i u ranomu srednjem vijeku je na dinarski prostor i istočni Jadran genetski stigla velika doselidba Iranohrvata, a ne navodna idejno napuhana "Seoba Slavena" od koje su sada preostale samo pljačkaške provale muških Slavena bez žena i naroda.


Genske podvale Irana i Kavkaza :

Neutralni i vjerodostojni genski nalazi u “kriznom regionu” s nepodobnim Irancima iz “osovine zla” očito ne odgovaraju svjetskim centrima moći, pa Veliki Brat naređuje da nije tako kako je nađeno nego će biti ono što Mi kažemo (tim gorje po činjenice). Tada 2 američke ekipe (Regueiro i sur. 2006 i 2009) revidiraju te rusko-iranske i kavkaske nalaze, ali kako nemaju pristupa u sam Iran i Rusiju, kao podlogu zlorabe njihovu emigraciju na Zapadu. U ovima ideopolitički naštimanim i manipuliranim izvješćima bez sigurne lokacije uzoraka, naš je dinarski tip posve izbačen iz Irana i Kavkaza (= 00%) i umjesto njega su mnogostruko povećani semitski tipovi pa su tako amerikanizirani Iranci demokratski prebačeni iz dosadanjih Indoeuropljana u nove genske Semite (slično je potom učinjeno još s inim susjednim narodima gdje je naš dinarski tip isto naknadni "uklonjen").

Zbog tih očitih manipulacija, javno protestira više neutralnih i uglednih genetičara iz Poljske, Skandinavije i inih u Europi, ali ove ekipe genskih revizionista ne reagiraju pa se pod dirigiranim pressingom zapadne “sedme sile” ovi naštimani nalazi i dalje uporno ponavljaju kao jedina vjerodostojna stvarnost (triput ponovljena laž konačno postaje istinom!). Istu podvalu o lažiranoj genetici Irana i Kavkaza sada ponavljaju naši slavisti i jugogenetičari kao vrhunski dokaz da Hrvati nemaju nikakve veze s Iranom ni Azijom, dok one vjerodostojne i detaljne razrade s dinarcima (Nasidze i sur., itd.) nikad ne spominju niti ih ne žele znati, jer im se to ne uklapa u jugobalkanske dogme. Sad je bilo samo pitanje vremena da se sličan geostrateški recept manipulirane “genetike” primjeni i na nepodobne Hrvate, a kod nas doma je to puno lakše nego u Iranu i Rusiji zbog korumpiranosti niza poltronskih karierista, tj. starih jugokadrova i njihovih klonova u znanosti koji su za nagrade spremno revidirali našu jugogenetiku.


Rasni holokaust za I/Eu7 :

Nakon novih biogenetskih analiza brojnih naroda diljem Eurazije, uočene su značajne zajedničke paralele u genskom tipu i tradicijskom mentalitetu pripadnih populacija, koje se odnedavna zlorabe za geostrateško planiranje u svjetskim centrima moći protiv nepodobnih naroda iz “kriznih regiona”. Zato se nakon novih genetičkih otkrića u svjetskim centrima moći danas polutajno i sustavno programira sofisticirana pacifikacija i rasturanje nepoželjnih populacija, bilo ekonomskim obuzdavanjem i genskim razvodnjavanjem (u nas već na djelu), a ako to ne uspije slijedi prisilno raseljavanje i demografsko rasturanje naroda kao konačno rješenje, prema gornjem iskrivljenom genskom spektru za Iran, Hrvatsku, itd. Kod nas je to već započelo javnim ocrnjivanjem “bijelih čarapa” i potom onemogućavanjem i raseljenjem Hercegovaca kao genske tvrde jezgre Hrvata, a dio iste genske selekcije već su ranije izvršili kod Bleiburga.

To znači da nas u ime buduće demokracije očekuju novi sofisticirani 'blajburgi', a potom bi preostala polovica podatnih nedinarskih Hrvata od svjetskih moćnika možda bila prihvatljiva za globalnu demokratizaciju tih zombija i nestanak hrvatskog identiteta zauvijek. Po pragmatičnom scenariju Velikog Brata kao u Iraku, sve te nepodobne i samosvojne populacije dinarskog tipa I1b od Jadrana do Irana ubuduće će na bilo koji način nestati rasturanjem ili likvidacijom, po starom uspješnom iskustvu kao s američkim Indijancima ili Aboriginima u Australiji. Iako u dostupnim tiskovinama ovi imperijalni planovi iz geostrateške genetike zbog taktičkih razloga zasad još nisu javno obznanjeni, ipak je poredbenom računalnom analizom brojnih infomacija i naznaka diljem interneta sve jasnije, kako je u svjetskim centrima moći već hladnokrvno odlučeno da zbog uspješne kontrole i pacifikacije tih “kriznih regiona” dinarski genotip I2a većinom treba rasturiti i ukloniti tj. da Hrvatska, Bosna, Kavkaz, Kurdistan i Iran u dogledno vrijeme moraju postati “Dinaridenfrei”. Na tim novim demokratskim planovima monstruoznoga genskog uškopljenja cijelih naroda, pozavidio bi im čak i poznati doktor Mengele koji je u tomu bio tek naivni početnik ...


Ucjene i kazne genetičara :

Svjetski najpoznatiji slučaj ideopolitičke ucjene i kažnjavanja priznatoga genetičara i nobelovca je dr. James Watson koji je prvi razotkrio biokemijsku strukturu DNK-genoma i za ovo ključno otkriće dobio Nobelovu nagradu 1962, a potom je bio i voditelj glasovitoga svjetskog Projekta ljudskog genoma 1964-1989. Unatoč svih tih zasluga, dostignuća i ugleda, dr. Watson je od 1990tih proglašen sumnjivim i od ljevičara javno stigmatiziran kao 'kontroverzan', jer se kao profesionalni genetičar usudio stručno progovoriti negativno o istospolnim odnosima. Konačno ujesen 2007, kada je znanstveno pronašao kako postoje prirodne razlike genskih predispozicija izmedju raznih ljudskih rasa, po njemu se u ime ljevičarstva i političke korektnosti osula najžešća ideološka paljba u javnosti i medijima: Zato ga je njegova vlastita istraživačka ustanova (Cold Spring Harbour Laboratory) koju je osnovao i vodio niz godina kao ugledni ravnatelj, po direktivi svrgnula s rukovodstva i izbacila iz članstva. Nakon toga je ova ideološki-politizirana ustanova izgubila znanstvenu vjerodostojnost i preostaje joj jedino da se zatvori. Slično vjerojatno očekuje i naše pseudo-genetičke manipulante, npr. Antropološki institut.


Lažnogenske ustanove i časopisi :

Ovdje se spominju tek neke najistaknutije ustanove i časopisi, koji su se istakli markantnim primjerima lažirane 'genetike' naštimane po političkim kriterijima iz centara moći :

- Ustanove : Antropološki institut (Zagreb), Cold Spring Harbor Laboratory, Biol.Dept. Florida University (Miami).

- Časopisi : Nature, Croatian Medical Journal, Human Heredity, Molecular Biology & Evolution.



Lažnogenska jugo-demagogija :

Ljudska genetika razvija se već više desetljeća, osobito kao pomoćna grana medicine i kriminalistike (npr. forenzika i nasljedne bolesti), ali je kao suvremena egzaktna struka najviše napredovala u zadnjih desetak godina. Tada su omogućene masovne biokemijske poredbe muških Y-kromosoma po očinskom naslijeđu paralelno s prezimenima, što se odnedavna proširilo na analize većih populacija i biološkog iskona cijelih naroda. Tako je dosad proučena većina naroda diljem prostrane Eurazije, uz ine također Hrvati i većina naših susjeda.

Na početku svog razvitka do 2005, znanstvena antropogenetika je bila objektivna i vjerodostojna, sve dok se u nju nije umiješala ideopolitika i geostrategija. Potom kao i u drugim sličnim slučajevima npr. s atomskom energijom i kloniranjem, sada u pragmatičnoj antropogenetici započinju strateško-ideološke manipulacije i zlouporabe kao sastavni dio specijalnog rata. Prvi eklatantni primjer toga neznanstvenog skretanja postala je genetika neprijateljskih Iranaca u američkoj interpretaciji, iz čega nastaje obrazac koji su Britanci sada primjenili i na nepodobne Hrvate. Najnoviji javni rezultat toga je sadanja repriza kontroverznog filma “Genetsko podrijetlo Hrvata” u režiji Hrvoja Juvančića, koji nam se u 4 nastavka nameće preko HTV-a u lipnju i ponovo u kolovozu 2007 i iznova opet 2008, itd.

Prvi oskudni i provizorni navodi za genetiku Prednje Azije i Irana spominju se od 2001, u nekoliko općih pregleda Azije koji dijelom zahvaćaju i Iran, a ti su nalazi značajni i za nas zbog mogućeg iranskog iskona ranih Hrvata. Novije detaljne i suvisle genetske analize na par tisuća uzoraka iz Irana, Kavkaza i Kurdistana nedavno je objavila vjerodostojna međunarodna ekipa ruskih, njemačkih i iranskih istraživača tj. Ivan Nasidze i suradnici 2004, 2005, 2006. i 2007. Pritom su u Teheranu našli čak 34% ili 1/3 naše dinarske haplogrupe I2/Eu7, pa u devetmilijunskoj prijestolnici Irana sad živi oko 3 milijuna nama sličnih dinaraca tj. više nego u Hrvatskoj. Taj dinarski tip je manjeviše raširen na sjeverozapadu Irana i južnije do Isfahana (17 %). Potom je ova ekipa također kod sjevernih Kurda u Turskoj našla 33% istoga dinarskog tipa, a ostali Iranci i Kurdi pripadaju istočnoeuropskom haplotipu (R1a ili Eu19) i dio semitskim tipovima Eu9 i Eu10 zbog utjecaja južnih arapskih susjeda. Ipak su najveće udjele našega dinarskog tipa našli kod kavkaskih gorštaka: na Kavkazu 31% do 82%, a još dalje na istoku taj naš tip doseže od 5%-12% duboko u središnju Aziju sve do Kirgizije i Fergane. Sve to jasno potvrđuje da su hrvatski, kavkaski i iranski dinarci sigurno zajedničkog iskona i u ranoj papovijesti ili predhistoriji su morali biti u izravnom fizičkom dodiru.

Prve genske analize Hrvata od više raznih autora na nekih 730 uzoraka u god. 2000.- 2004. (Primorac i Marcikić, Ivan Jurić, Marjanović i suradnici, Rudan i sur., itd.), kod nas su pokazale dominaciju osobitoga dinarskog haplotipa I1b (ili Eu7) od 45% do 48% tj. blizu polovice Hrvata, a u Hercegovini i na dalmatinskim otocima taj naš tip doseže preko 70%. Naprotiv istočnoeuropski haplotip R1a (ili Eu19) sličan ostalim Slavenima, u Hrvatskoj obuhvaća tek 23%-28% pučanstva, a samo na zapadu (Istra i Gorski Kotar) ovaj tip prelazi više od 1/3 uzoraka. Iz toga su neutralni inozemni genetičari Passarino, Chikhi i drugi zaključili da unatoč jeziku, Hrvati po genskom iskonu nisu Slaveni. Danas to još oštrije potvrđuje neutralna međunarodna ekipa od desetak slavenskih genetičara (Krysztian Rebalja i Aleksej Mikulič s više suradnica iz Poljske, Ukrajine, Slovačke i Rusije) koji su 2007, objavili završni smrtni udarac jugo-genetici - o čemu naši ideologizirani jugogenetičari taktički uporno šute.

Iz opsežne genske poredbe svih jezičnih Slavena, ova sveslavenska ekipa je nedvojbeno dokazala kako pravi genski Slaveni grupe R1a tj. zajedničkog iskona danas žive od Češke do Ukrajine i Sibira. Naprotiv među tzv. "južnim Slavenima" su slavenskoga genskog iskona stvarno samo Slovenci i dio najzapadnijih Hrvata (uz Sloveniju), a većina inih Hrvata u Hrvatskoj i Hercegovini, pa Bošnjaci, Srbi i Bugari su prvotni genski neslaveni koji su tek naknadno po jeziku slavizirani u kasnije doba. Tako je, nakon prvih Primorčevih nalaza koje su naši jugoslavisti htjeli odbaciti i omalovažiti, sada još slavenska međunarodna genetika ponovo i zauvijek pokopala južne Slavene u ropotarnicu povijesti.

Međutim, sada su sramotno oživljavanje te južnoslavenske mumije preuzeli Britanci zbog drage neprežaljene Jugoslavije i njihove buduće Balkanije i treće Jugosfere. Odonda oni potiču organiziranu paljbu protiv neprihvatljive genske većine nepodobnoga dinarskog tipa među Hrvatima, uz sofisticirano teorijsko obrazloženje Juvančićevog suradnika dr. Dušana Sekulića iz Australije za neizbježnu nužnost tog pristupa. Prvi imperialni plotun ispalio je britanski časopis “Nature” u znanstveno nedostojnom ideopolitičkom pamfletu o rasističkoj genetici Hrvata za poništenje dosadanjih genskih nalaza. Isti još potiču domaće znanstveno ukidanje ranijih nalaza, što tiskaju Rudan i ekipa 2005, a to je bio naručeni pismeni scenarij sadanjem filmu.

Istodobno se u pozadini spremao taj film za široku javnu promičbu lažnogenske revizije Hrvata i slavensko ispiranje hrvatskih mozgova kao u ranijoj Jugoslaviji. Kao nagrade za uspješno obavljene usluge ukidanja hrvatskog identiteta i genskog oživljavanja Slavenohrvata, prof. Pavao Rudan ubrzo postaje akademikom pa dobiva prilična sredstva i novi prostor instituta, a režiser Hrvoje Juvančić nagrađen je diplomom za taj loši i lažirani film koji će zauvijek ostati promašaj hrvatske kulture. Evo glavnih 'bisera' iz tog filma i pripadnoga pseudoznanstvenog članka 2005, koji nemaju veze s današnjom znanstvenom stvarnosti, pa je javna sramota za HTV da se ta zastarjela blezgarija za ideološko ispiranje mozga u 4 nastavka čak triput reprizirala u 21. stoljeću :

    a) Iz tzv. 'hrvatskoga' genskog prosjeka su izbačeni i izostavljeni idejno-nepodobni nalazi Like i Dalmacije s premalo slavenskog R1a i previše I2 (tim gorje po činjenice), pa sad politički korektno 'glajhšaltani' novi jugo-Hrvati već imaju podnošljivih 33% R1a + 34% I2: Taj je brainwash od 2005. nadalje javno i uzastopno obznanjen, pa citiran kroz niz časopisa i ponavljan popularnom filmskom emisijom kroz TV. Time Hrvati postaju genetski podobni i prikladni za Jugosferu i Balkaniju, pa Antropološki institut dobiva poveća sredstva i opremu, a organizator prof. P.Rudan postaje akademikom. Doduše, protiv toga javno protestiraju drugi, kao i sveučilišni genetičar prof.dr. Ivan Jurić koji je novim analizama potvrdio i proširio ranije rezultate do 2004. i prokazao krivotvorbe,- ali bez učinka jer "psi laju-karavana prolazi" tj. očite krivotvorbe se uporno nastavljaju u podobno-naručenu geostratešku pseudoznanost.

    b) Posve su prešućeni i izostavljeni drugačiji novi nalazi svih ostalih naših genetičara (Primorac i Marcikić 2000, Jurić 2003, 2004, 2005, Marjanović i sur. 2006 i dr.) pa niza nezavisnih stranih istraživača o Hrvatima (Passarino, Semino, Chikhi, Rebalja, Mikulič ... itd.) koji se idejno ne uklapaju u te stare jugoslavističke dogme jer navode posve neslavenski genski spektar oko 76% Hrvata. U egzaktnim znanostima se takvo namjerno izostavljanje i prikrivanje “nepodobnih” podataka smatra za nestručnu laž i falsifikat, jednako kao i prepravljanje naštimanih rezultata, ako se ne može potvrditi ni ponoviti iz drugih nezavisnih izvora koji su za genetiku Hrvata međusobno slični, od čega samo Rudanovci daleko odskaču. Takvim dirigiranim obratom Rudanova klapa je "ukinula" ne samo sve egzaktne nalaze drugih nezavisnih genetičara o Hrvatima, nego su zapravo poništili i vlastite rezultate Antropološkog instituta prije god. 2004.

    c) Poznati inozemni genetičari Cavalli-Sforza i Ornella Semino nelogično su nakalemljeni na početak filma kao ukrasne maskote bez sadržaja, da svojom pojavom tobože "ovjere" istinitost te balkanske papazjanije. Uporno mahanje epruvetama i bijelim kutama ima tek dekorativnu ulogu za obmanu naivnih i neupućenih gledatelja da povjeruju toj tobože “visokoj znanosti”. Iza toga su zapravo stare balkanske dogme jugoslavista reciklirane kao dio specialnog rata protiv hrvatskog identiteta i državnosti. Stvarni naručitelji i financieri toga reciklažnog filma o jugo-genetici Hrvata se nalaze na istoj adresi organizatora Zapadnog Balkana, odakle je već lansiran ideopolitički pamflet o genetskom rasizmu dinarskih Hrvata iz časopisa “Nature”.

    d) Uzastopce ponovljeni kružni diagram s lažno-naštimanim postotcima genskih grupa i haplotipova nije neki znanstveni prikaz, nego tek ideološka krivotvorba za obmanu javnosti. To nisu stvarni genski prosjeci većine Hrvata, nego za jugoslaviste najpovoljniji djelomični prosjek iz sjeverne i zapadne Hrvatske, gdje je “slavenski” genski udjel prividno veći nego drugdje kod nas. Od stvarno nađenih 45% do 49% našega dominantnog dinarskog haplotipa što obuhvaća oko polovice Hrvata, u tom je filmu po jugoslavističkoj direktivi nasilno skresano na podnošljivih 33%, dok je minorni istočnoeuropski tip od stvarno nađenih 23%-29% kod četvrtine Hrvata, tu umjetno napuhan na poželjnih 33% da bude bliži Slavenima i na razini dinaraca. Zato su iz toga lažnog grafičkog prosjeka namjerno i tendenciozno izbačeni neslavenski Hrvati u 2/3 Hrvatske tj. Slavonci, Ličani, Dalmatinci i Hercegovci koji se genetski većinom ne uklapaju u Slavene. Takve statističke podvale i manipulacije iste ekipe već je ranije javno kritizirao i prof. dr. Ivan Jurić iz Zagrebačkog Sveučilišta, pa su potom ovi Rudanovci morali objaviti isprike i ispravke u istom časopisu gdje je izašla ta njihova naštimana jugogenetika, što je znanstvena sramota.

    e) Također je zbog jugoslavista izmišljen neznanstveni navod, kako su slavenska i dinarska haplogrupa tobože najbrojnije i ograničene u istočnoj Europi. Ipak novije šire genetske analize istočnije u Aziji nam jasno dokazuju kako je naša dinarska haplogrupa (I2/Eu7) također vrlo obilna kod sjevernih Kurda u Turskoj (33 %), pa u Teheranu 34 % i najveća na Kavkazu 50 - 80%. Jednako i tzv. “slavenski” haplotip (R1a/Eu19) nije najbrojniji kod istočnoeuropskih Slavena, nego doseže puno istočnije do srednje Azije gdje je najviši u neslavenskoj Kirgiziji i Tadjikistanu do 50-70%. Povrh svega, inozemne analize ove istočnoeuropske haplogrupe u njemu pokazuju 2 razna podtipa (Passarino i surad. 2001) tj. pravi slavenski na sjeverozapadu (a*) i južniji indijski (a1) najviše u Iranu i Pakistanu (Qamar i surad. 2002), koji su kod Hrvata nazočni u omjeru slavenski 2 : indijski 17. To znači da su većina tzv. “slavenskih” Hrvata zapravo genski neslaveni indovedskog iskona, pa je od toga lažiranog genskog slavenstva iz ovog filma kod Hrvata sad preostalo zamalo ništa tj. tek 4% pravih genskih Slavena među nama.

    f) Nadalje, skupa terenska ekspedicija i jurnjava bez organizirane svrhe vozilom HTV kroz srednju i istočnu Europu isto je nestručna podvala, jer su tu za naivnu javnost tendenciozno prikazana mjesta s nazivom sličnim Hrvatima jedino u slavenskim zemljama od Panonije do Ukrajine gdje o tom intervjuiraju ulične pijance, kao da nema sličnih hrvatskih imena obilno drugdje izvan slavenstva. Zato su prešućeni i izbačeni očiti neslavenski nazivi po Hrvatima iz južne Grčke, Peloponeza i otoka sve do Krete. Tu nikad nisu plovili nekakvi Slaveni, ali je zato u Grčkoj baš na Kreti uz naše toponime po Hrvatima i najviši udjel od 16% dinarskoe haplogrupe, što su razradili mediteranski genetičari Ceriani i surad. 2005, pa Dienekes-Pontikos 2007. Naprotiv slavenski tip tu južnije zamalo izostaje, a u sjevernoj Grčkoj je slavenski genetski udjel najviši do 35%, ali tu gore opet nema hrvatskih toponima pa su ovi ranohrvatski dinarci na jugu Grčke očito stigli morem s Jadrana. Isto su u tom tendencioznom filmu dosljedno zaobiđeni brojni prastari nazivi po Hrvatima iz Turske, Libanona, Sirije, Irana, Pakistana i Afganistana tj. doslovce sve o Hrvatima što je vremenski i prostorno izvan slavenstva. Zato je sav taj zemljopisni košmar u filmu tek lažirana podvala za obmanu hrvatske javnosti zbog stvaranja treće Jugosfere ili Balkanije.

    g) Od svega što nam je triput ponovljeno u toj filmskoj reprizi, znanstvenoj stvarnosti i modernim spoznajama iz 21. stoljeća pripadaju samo skraćene i cenzurirane izjave antropologa dr. Šlausa i ukrajinskog arheologa prof. dr. Oresta Korčinskog o Bijelim Hrvatima. Zamalo sve ostalo što je nadrobljeno u tom filmu, uglavnom je bezvrijedna gomila demagoških podvala bez stručne vrijednosti za dnevnopolitičke namjene stvaranja nove Jugobalkanije. Glavni ideolozi koji su očito osmislili tu filmsku podvalu, jesu već dugo poznati naši sveslavenski jugodogmati koji su potakli i zlorabili HTV i Antropološki institut za reciklažu i oživljavanje u novom pakovanju njihovih već odavno pljesnivih jugoslavenskih obmana zbog ujedinjenja Zapadnog Balkana i treće Jugosfere, gdje bi oni opet bili u svom elementu – umjesto da su već odavno lustrirani.


Ine metastaze slavenomanije :

Metastaze slavenomanije u prirodoslovlju i inoj znanosti : Sveslavenstvo je u novoj Hrvatskoj kao ideološka religija naslijedjeno većinom nepromjenjeno nakon raspada Jugoslavije, pa su slavofilski klanovi dosad očuvani u mnogim društvenim i prirodnim strukama, a manje u primjenjenima gdje sama praksa otežava takvu nastranu ideologiju. Kao najopasniji tvrdokorni slavenomani, održali su se u društveno-humanističkom području fanatični vukoslavci (Vukovci), a u prirodoslovlju su im posve slični ekstremni bioslavci. Blaži oblici nomenklaturne slavofilije prošireni su kod nas u zamalo svim strukama, uglavnom kao uvodjenje i podržavanje srbobalkanskog stručnog nazivlja umjesto našega izvorno-hrvatskoga. Teži ekstremi su faktografska slavenomanija kojom se svjesno i namjerno prešućuju, izkrivljuju i krivotvore temeljni sadržaji i ključni podatci, na koje se potom nastavljaju lažne i promašene nadgradnje u prilog jugoslavenstva.

Krajnje metastaze ove paraznanstvene perverzije (= Slavonimania chronica et acuta), kod nas su se razvile u slaviziranim paraznanostima na primjeru lingvistike, povijesti i biologije. Osim tih, faktografska slavenomanija je više-manje zarazila i druge struke u Hrvatskoj, npr. etnologiju koja dosad proučava samo neke pojave u skladu s našim slavenstvom, dok se zamalo sve ine kod Hrvata odbacuju i zanemaruju kao strane (romanske, germanske itd.). Slično je i u “Zagrebačkoj geografskoj školi” (sveučilište) gdje se sve nateže na poželjno slavenstvo-balkanstvo. Većina slavofilskih nastavnika na školama i neki ekstremni slavenomani na sveučilištu sve dosad javno i uporno zaludjuju i kloniraju nove slavenomane i slavenofilne debile u mladjim naraštajima u svrhu dekroatizacije i gubitka identiteta. Čak oko 1/3 gradiva koje se “proučava” i predaje studentima Filozofskog fakulteta u okviru povijesti, slavistike i etnologije, kao i 1/5 na PMF-u iz geografije i biologije, jesu ideološke paraznanstve krivotvorbe proizašle iz naše stoljetne slavenomanije kroz 20. stoljeće i tim promašenim studiranjem je upropašten dugi niz naših akademskih naraštaja, a da za to nitko odgovaran ne snosi posljedice.

Premda bi po tematskoj naravi prirodoslovlje trebalo biti izvan slavenstva, ipak nakon državnog udara 1972/73, ideološki slavofili prisvajaju kontrolu čak i u našoj biologiji, gdje je slavenomania dosad već dostigla jednako stravične razmjere kao u povijesti i jeziku. Blaži oblik te slavofilske nastranosti, kao i u većini znanstvenih struka kod nas, bilo je ukidanje i odbacivanje hrvatskih narodnih naziva za vrste i skupine bilja, faune i ine prirodne pojmove, uz njihovu nasilnu zamjenu u literaturi i nastavi srbobalkanskim nazivljem. Ovo počima još od 1918, pa je dosad ukinuta i balkanizirana većina naših bionaziva, izim par najobičnijih vrsta iz svakodnevnog života koje su još zadržale hrvatska imena.

Nakon toga uspješnog jezičnog udara u prirodoslovlju od 1972. počinju čak tvarne podvale tj. krivotvorbe podataka i prirodnih činjenica u skladu s jugoslavenskim fanatizmom. Do 1975. je u našoj akademskoj biologiji po partijskoj direktivi S.Šuvara smaknuta većina normalnih istraživača i medjunarodnih autoriteta, a nametnuti su provjereni partijski kadrovi s instant-naobrazbom (podobni prirodoslovni diletanti), koji sada dijelom mijenjaju predznak prema suvremenom globalizmu - ali im je razorna djelatnost u prirodoslovlju ista. Tom slavenomanijom već manjeviše zaraženi Prirod.matem. fakultet, muzeji, Akademija i Leksikografski zavod, koje sad idejno kontroliraju slavofilni prirodoslovci (bioslavci), kojih je paraznanstveni učinak u našem prirodoslovlju već dosegao absurdne razmjere :

    a) Više stotina nepodobnih “neslavenskih” vrsta bilja i faune kojih nema u inim istočnim slavenskim zemljama, ideološki su odbačene, nepriznate i prividno “izbrisane” iz prirode u Hrvatskoj, iako su tu većinom poznate i dokazane još od doba objektivnih austrougarskih ili talianskih istraživača neopterećenih jugoslavizmom.

    b) Priroda Hrvatske a nadasve dinarski kras i otoci, odprije su u svijetu poznati bogatstvom posebnih hrvatskih vrsta (tzv. endemi i relikti) od kojih je tim bioslavskim fanatizmom većina umjetno ukinuta i izbrisana jer ih većinom nemaju ine slavenske zemlje.

    c) Da se lažno i prividno "slavizira" priroda u Hrvatskoj, nasilno nam se nameće prirodoslovno bratstvo-jedinstvo: umjesto gornjih nepodobnih vrsta, bioslavci nam umjetno i lažno navode diljem Hrvatske druge, podobne “slavenske” vrste iz istočnih slavenskih zemalja, koje u našoj prirodi većinom ne postoje.

    d) Umjesto stvarnog proučavanja i prikaza prirode u Hrvatskoj, ovi ideologizirani bioslavci većinom umjetno i paušalno, bez terenskog uvida i istraživanja prepisuju i preslikavaju nepostojeći biljni pokrov (vegetaciju) iz dalekih slavenskih Karpata na dinarski kras, a podobnu vegetaciju Panonije na našu obalu i otoke kao da je Jadran slaveno-panonska močvara, pa su te “slavizirane” prirodoslovne karte Dinarida i Jadrana većinom bezvrijedne i promašene.

    e) Ta bioslavska nastranost ima još dalje metastaze i u ekozaštiti prirode. Osim par klasičnih nacionalnih parkova (Plitvice, Krka, Paklenica) koji su ranije dobro odabrani po medjunarodnim prirodoslovnim kriterijima, većina inih novijih rezervata kod nas imaju vrlo dvojbenu i prividnu vrijednost: uglavnom su položeni po nastranim bioslavskim načelima da sadrže samo podobne “slavenske” vrste, dok su puno bogatija područja u blizini s obiljem nepodobnih hrvatskih vrsta posve nezaštićena i izložena uništenju (kao i naša kultura: dolje sve hrvatsko !).

    f) Čak u našoj hortikulturi, po drvoredima i gradskim parkovima sada se uporno sade poznati vrtni simboli sveslavenstva i jugobratstva tj. lipe, breze i omorika, ali nijedna hrvatska vrsta nepodobnog drveća.

    g) To bioslavsko mahnitanje već prelazi sve granice tvornim napadima i fizičkim uništenjem nepodobnih hrvatskih rariteta, kojih je nedavno desetak već istrijebljeno da se “dokaže” njihovo nepostojanje. Najgori krajnji slučaj toga bioslavskog kriminala je uništenje posebne hrvatske jele (Abies pardei) na našim obalnim Dinaridima, koje nema izvan Hrvatske i medjunarodno je priznata, jer su ju pronašli i proučili britanski i francuski stručnjaci - ali naši suludi bioslavci su svjesno i namjerno odredili njezin genocid, jer ideološki ne može i ne smije postojati: nakon tog eko-pogroma, od ranijih 16 četvornih km njezinih šuma 1980, sada je preostalo tek par stabala!

    h) Visoko pozicionirani bioslavci s (polit-)akademskim titulama danas već strogo kontroliraju većinu prirodoslovnih izdanja u Hrvatskoj, da se u njima prikazuju samo podobne (slavenske) vrste i poneke općeraširene, dok se hrvatske prirodne osobitosti ne smiju spominjati ili tek općenito bez nepodobnih detalja.

    i) To se bioslavsko ludilo kod nas (kao i u kulturi) dalje klonira u sveučilišnoj nastavi prirodoslovlja pa nakon Titova državnog udara 1971, od osamdesetih godina kod nas studije završavaju bioslavski debili i prirodoslovni invalidi koji većinom nemaju pojma o ključnim prirodnim osobitostima Hrvatske, osim o lažno nametnutoj “slavenskoj” prirodi zemlje.

    j) Nakon tog niza prirodoslovnih krivotvorbi, postaje logično i očekivano da se nastojalo na sličan način krivotvoriti iz pozicija nametnute slavenomanije i naše podatke antropološke genetike, kako je to gore prikazano.


Slavenomania je bolesna kolektivna psihoza, kao posljedica “izpiranja mozgova” i gubitka izvornoga hrvatskog identiteta u bivšoj Jugoslaviji. Ona pripada grupi deviacija lažnog identiteta i treba ju liječiti znanstvenim prosvjećivanjem u kombinaciji s grupnom psihoterapijom. Tu opet važi ranija dalekosežna najava vidovitog Ante Starčevića, kako je naše „slavstvo na javi ludovanje !“. Prvu jasnu definiciju slavenomanije kao društvene bolesti dao je već dr. Ante Starčević 1867, u svom djelu “Bi li k slavstvu ili ka hrvatstvu” i inim svojim radovima. Kako su njezine posljedice kod nas vrlo ozbiljne i dugoročno štetne, moraju se učinkovito sanirati i spriječiti da ne stvaraju dalje lančane probleme. Kroz 70 godina jugo-školstva, jugo-drilani nastavnici i poltronski novinari režimskih medija su nametali i podržavali takvu slavenomaniju kao društveno poželjan i normalan nazor u javnosti i našoj znanosti, što se većim dijelom nastavlja sve do danas. Dosad još nijednomu europskom narodu nisu nametnute tolike podvale o povijesti, jeziku, kulturi i prirodi kao Hrvatima. To nedvojbeno pokazuje da su naši akademski slavenomani s predrasudama za probitak sinekura, zbog krivih i naštimanih polaznih podataka, tek naizgled savršenim i razradjenim metodama ustvari naučavali i dokazivali društveno-povijesni perpetuum mobile.



Slavenorasizam u Hrvatskoj :

Tako je naše sveslavenstvo postalo slična alternativna paraznanost kao npr. parapsihologija, alternativna medicina itd. Brojni su naši akademski uglednici stekli kariere i privilegije na prodaji te paraznanstvene magle i na tomu su se organizirale cijele interesne mafije, osobito u povijesti, lingvistici, etnologiji i čak u slaviziranom prirodoslovlju, a pri svemu tom su sramotne uloge imali sveučilište, akademija i ministarstva znanosti, školstva i kulture. Kroz 20. stoljeće se veliki dio hrvatske znanosti od jezika i povijesti sve do biologije temeljio na promašenim aksiomima južnoslavenske dogmatike, pa su i kriteriji vrednovanja rezultata bili tek formalno-dekorativni bez temeljnih medjunarodnih standarda, a da nitko iz znanstvenog establishmenta nije reagirao. Ovi organizirani paraznanstveni klanovi slavenomana u raznim strukama su izravno ili preko političkih “kumova”, raznim ucjenama i stručnim izopćenjima u javnosti uzastopno onemogućavali bilo kakve kritike i čak blaže upozorbe na njihove manipulacije i neodrživost tog stanja. Zbog njihovih monopola i embarga na stručne i ine publikacije, cijeli niz inače koristnih i informativnih tekstova nisu se mogli ni smjeli objaviti u našim medijima.

Zbog duboko ukorijenjenog jugoslavizma, zamalo nigdje u istočnoeuropskim zemljama ekstremni slavenorasizam nije dosegao takove zastrašujuće oblike kao u Hrvatskoj. Npr. Rusi, Poljaci, Česi, Bugari i ini Slaveni su nacionalno jasno definirani i nije im nužna poštapalica u identifikaciji njihovo slavenstvo, kao genetski neslavenskim i iskompleksiranim Hrvatima. Tko god se ovdje kod nas izjašnjava da nije Slaven, odmah je automatski stigmatiziran kao manjinski stranac i izopćen iz društva, a donedavno je bio i fizički ugrožen zatvorom i progonom Udbe, pa ga još i danas naša zaluđena javnost drži za nastranog čudaka i biće niže rase, približno kao crnce u Americi. Uglavnom oni isti licemjeri koji su donedavna kao ‘antifašisti' galamili protiv germanskog rasizma, danas su glavni predvodnici toga domaćeg slavenorasizma.

Najnoviji i najekstremniji oblik toga domaćeg slavenorasizma nakon novih genetskih otkrića je kroz zadnjih 5 godina organizirana medijska hajka protiv hrvatskih Dinaraca i Hercegovaca (tzv. "bijele čarape"), koja je započela od 'trojanuarskih' izbora 2000. Baš istodobno od god. 2000. je i svjetska biogenetika jasno i nedvosmisleno dokazala da su ti isti nepodobni Dinarci većinska genetska okosnica bar 45% hrvatskog naroda indoiranskog iskona. Ukratko: ta novija hajka na Dinarce ustvari su programirane rasističke orgije u okviru organiziranog kaosa za idejnu i potom fizičku likvidaciju hrvatskog naroda i preuzmanje njegove zemlje, u čemu složno djeluju zainteresirani inozemci i njihovi domaći janjičari zbog osobnih probitaka i jugoslavenske zaluđenosti. Osim fiksne ideje sveslavenstva u glavama, većina tih naših zastupnika slavenorasizma fizički dakako nemaju zajedničkih gena s inim Slavenima, nego su tek fanatizirani slavenofilni janjičari.

Kad su se Hrvati počeli doseljavati u nekoliko valova iz ukrajinske Crvene Hrvatske (Velike Horvatiye) i Bijele Hrvatske koja je bila otprilike na području danasnje Poljske (U poviesti je bilo do tri Bijele Hrvatske države koje su se teritorijalne sve više približivale području današnjoj Hrvatskoj) nisu našli praznu rimsku provinciju Ilirik/Dalmaciju bez stanovnika. Tu su odavno živjeli Iliri/Dalmatini, samo što nisu više imali vladavinu rimskog carstva nad sobom. Iliri/Dalmatini nisu uspjeli ostvariti državu a kad su Hrvati došli na današnje područje su odmah počeli s uspostavom Panonske Hrvatske, Crvene Hrvatske i Bijele Hrvatske. Crvena i Bijela Hrvatska na današnjim područjima se direktno mogu povezati sa stanovnicima ukrajinske Crvene Hrvatske i poljske Bijele Hrvatske. Pretpostavlja se da je Panonska Hrvatska naseljena stanovnicima Crne Hrvatske o kojoj se na žalost jako malo znade.

Hrvati su nastali u Indiji/Pakistanu i po njima se je nazvala Sarasvati Civilizacija na obalama rijeke Indusa i rijeke Sarasvati.

Rijeka Sarasvati se je presušila i Hrvati su pošli prema dansnjom Afghanistanu i Iranu.

Tada su se ti stari Hrvati prvi put miješali genetski sa narodima koje su tamo zatekli. U današnjem Iranu su živjeli prije Iranaca. Dok su Iranci došli na njihove današnje teritorije su tamo našli Hrvate. Hrvati su primili Perzijance prijateljski i od tada su stari Perzijanci koristili za riječ "prijatelj" staro-perzijsku riječ "hu~urwatha". Hrvati i Perzijanci su se miješali sve dok Hrvati nisu napustili perzijsko područije u pravcu današnje Ukrajine. Još i dan danas Iranci uče u skoli o petom perzijskom plemenu (tako nazivaju Hrvate) koji su napustili Iran u nepoznatom pravcu.

Kad su Hrvati došli na područje Ukrajine su več našli tamo slavenske narode koji nisu imali svoju državu i uspostavili nakon iranskog doba gdje su imali nekoliko kraljevstva i gradski-kraljevstva Veliku Horvatiyu (Veliku Hrvatsku). Velika Hrvatska se je proširila od današnje Ukrajine do Poljske. Hrvati su kao osvojači uzeli jezik od poraženi slavena, ali ostavili i neke riječi iz perzijskog doba (dušman, ...) u svom jeziku.

Crvena Hrvatska : Postojala je od IV. st. na području današnje Ukrajine, pa je Ukrajinci drže ranim pravno-politickim temeljem svoje državnosti. Orosius Presbyter ukrajinske Crvene Hrvate naziva Horiti, a Zacharias Rhetor Hrwts. Vikinški putopisci nazivaju je kraljevstvo Krowataland. Ruski i poljski ljetopisci Crvene Hrvate nazivaju Russiae Carvati, Rothe Krobatthen, Horvaty. Od godine 374. kralj Crvene Hrvatske je Ukromir (sastavnica mir u njegovu imenu u zapadnoiranskim i kurdskim govorima doslovce znaći vladar odnosno kralj - usporedi imena hrvatskih narodnih vladara : Trpimir, Branimir, Muncimir, Krešimir, Zvonimir). Nakon smrti kralja Mezamira (593.-602.) ukrajinska se Crvena Hrvatska konačno ujedinjuje sa zakarpatskom Bijelom Hrvatskom u Veliku Hrvatsku.

Bijela Hrvatska : Prostirala se na podrucju današnje Ceške, Moravske, Poljske i Slovačke. Političko središte ove države bio je najprije grad Samobor, a od godine 190. grad Hrvat (današnji Krakov - ime Krakov izvedeno je iz imena Hrvat) na gornjemu toku rijeke Visle. Od godine 869.-894. Bijelom Hrvatskom zavladao je svehrvatski kralj kraljeva Sventopolk-Budimir, koji je tada pod svojom krunom ujedinio većinu hrvatskih zemalja od Karpata do Dunava i Jadrana. U X. st. Bijelom Hrvatskom vlada domaća hrvatska dinastija Slavnikovića. Na kraju X. st. zaposjedaju je Česi i Poljaci.

Veliku Horvatiyu su presjekli Rusi na dva dijela koji su se poceli širiti na tom području. Jedan dio je bila Bijela Hrvatska koja je bila na području istočne Bavarske, južne Poljske i sjeverne Češke a drugi dio je bila Crvena Hrvatska. Obe Hrvatske su se razvijale odvojeno. Postojala je i cak treća, Crna Hrvatska, ali se o njoj skoro ništa ne znade. Hrvati su se u Bijeloj Hrvatskoj miješali sa Poljacima i drugim Slavenima a u Crvenoj Hrvatskoj sa drugim Slavenskim plemenima ali i sa neslavenskim narodima koji su se zatekli na tim području.

Zadnji hrvatski kralj Crvene Hrvatske je bio Vladimirović koji je imao 5 sinova. Najstariji sin je uspostavio Ukrajinsku naciju a najmladži sin Vladimir I. Vukotin Vladimirović je 1117 otišao na današnja područja i bio guverner Gornje Zete i Raške (za koju Srbi tvrde da je tobože srpska zemlja). On umire nakon žestoki borbi sa Srbima u blizini Prištine. Sin Vladimira I., Vladimir II. postaje Guverner Dalmacije. 1250 Vladimirovići preuzimaju vlast u Hercegovini i nakon žestoki borbi sa Turcima idu u Dalmaciju. Grgur Vladimirović od tog doba koristi ime Rukavina. Priča se da su ga Turci zarobili a on nije htjeo reći svoje prezime, pa taku su ga Turci imenovali "onaj sa visokim rukavima" (valjda je imao kaput da visokim rukavima). Tako da su Vladimirovići i Rukavine najplemetije obitelji Hrvatske i jedini su koji bi u slučaju monarhije imali najveće pravo na hrvatsku krunu.

Dolaskom Hrvata na današnje područije su naišli na Ilire/Dalmatine sa kojima su se opet izmješali. Današnja genetika to potvrdžuje jer se u današnjoj AVNOJ-skoj Hrvatskoj, Bosni, Sandžaku i Duklji nadže haplotip Eu7, za koji znatnstvenici govore da je Hrvatski gen.

Ipak se genetika razlikuje od naroda do naroda u postotku ostalih genski markera. Hrvati imaju zato totalno drukčiju genetsku strukturu od naprimjer Srba, koji vole tvrditi da su Hrvati nastali od Srba što nije samo genetski nemoguće nego je i poviesno nemoguće, jer se Srbi nisu pojavili prije ovih prostora a hrvatski tragovi se mogu dokazati do 3750 prije Krista u Iranu. Srbi najviše kao dokaz navode šalu satiričkog hrvatskog internet portala "news-bar" ( Očito su narod koji ne znade šta je satira.

Bilo kako bilo. Srbi imaju 49% altajsko-anadolski (turski) gena.

Mislim da vam je poznato da su Srbi živjeli 500 god. pod Turcima. Ono sto Srbi izbjegavaju reči je da su u tih 500 god. Srpkinje u pravom smislu riječi bile pod Turcima. To je neupitno i sa tim se vjerujem svi slažemo. Isto tako je poznato da su turske Age, Paše itd. morao prvu bračnu noć provesti sa svakom srpskom mladom nevjestom.

Isto tako nam je poznato da su nakon toga sto su radili te prve bračne noći vjerovatno mnoge mlade nevjeste (Srpkinje) ostale i u drugom stanju.

Sad kad se dijete rodilo što je to dijete bilo? Pola Turčin, pola Srbin. Mislim da se i oko toga možemo složiti i da je to nepobitna istina.

E sad idemo dalje.

Kad su ta djeca narasla, a bilo je među njima ko i u svim drugim slučajevima muških i ženskih i ona su se ženila i udavala. I sad imamo slučaj da je polu-turkinja oko koje smo se složili kod udaje ponovo bila prisiljena spavati sa turčinom. Ako je ona tada ostala u drugom stanju, a veliki broj od njih je, dijete koje se je nakon toga rodilo po mojoj računici bio je 75% Turcin, ili Turkinja. To se je dogodilo več u drugoj generaciji. Ako su se takva djeca kad su odrasli ženili imeđu sebe i njihova djeca su bila automatski 75% Turci. Sad ako se ta 75% srpkinja kod udaje ponovo spava sa Turčinom dijete tako začeto je več skoro 100% Turčin. I to nakon samo nekoliko generacija. Pošto je sve to trajalo 500 god. i oprilike 25 generacija osavljam sad vašoj mašti i vašim matematičkim sposobnostima da izračunate nakon 25 generacija kakvu genetsku sliku imaju naši istočni susjedi.

Srbi su tu genetiku samo mogli okrenuti zato što je Srpska Pravoslavna Crkva assimirilara druge pravoslavne narode : pravoslavne Dukljane (Hrvate), pravoslavne Vlahe, pravoslavne Hrvate itd. S tim potezom su uspjeli smanjiti dio anadolski (turski) gena na 49%.




 - haplotip Eu7 :
"hrvatski haplotip" : 44,83%

- haplotip Eu19 :
"slavenski haplotip" : 29,31%

- haplotipovi Eu4, Eu9, Eu10, Eu11 :
"neolitski haplotipi" : 13,79%

- haplotip Eu18 :
"baskijski haplotip" : 10,34%

- haplotip Eu16 :
azijatski haplotip : 1,73

- haplotip Hg2 :
"altajsko-turski (anadolski) haplotip" : 49%

- haplotip Eu19 :
"slavenski haplotip" : 19%

- haplotip Eu7 :
"hrvatski haplotip" : 5%

- haplotip Hg9 :
"avarsko-mongolski haplotip" : 6%

- haplotip Hg21 :
"afro-hamitski-haplotip" : 13%

- ostali haplotipi : 8 %


Ovakva genetička struktura slična je strukturama susjednih naroda jugoistočne Europe, iako postoje i određene razlike. Usporedbe s drugim narodima moguće je načiniti ukoliko su istraživanja njihova genetičkog podrijetla načinjena po istoj metodi: analizom haplotipova. Ukoliko se radi o starijim istraživanjima temeljenim na haplogrupama, može se samo izračunati sličnost podrijetla predaka uspoređivanih naroda.

Najuočljivija karakteristika prikazane genetičke strukture je visok postotak haplotipa Eu7, zbog kojega ga neki autori nazivaju hrvatskim haplotipom. Visoku učestalost Eu7 može se razumjeti proučavanjem redoslijeda pristizanja populacija na područje Hrvatske, uvjeta u kojima je dolazilo do povećanja brojnosti određenih populacija i drugih povijesnih promjena.

Hrvatski Muslimani u nekim krajevima Bosne imaju veči postotak tog hrvatskog genskog markera Eu7.

Kroz stoljeća je samo muslimanski muškarac mogao uzeti ženu ne-muslimanku i u nekim slučajiva ne-hrvaticu (Srpkinju, Vlahkinju, ...) koje je ond morala prihvatiti Islam. Dok su kod hrvatski katolika i muškarac i žena mogia uzeti ne-Katolika i u nekim slučajima ne-Hrvata (Srbina, Vlaha, ...) i pokvariti s time svoji genetiku, to naprimjer muslimanska žena nije mogla.

Islam je zato više očuvao hrvatsku krv nego katoličanstvo. To se baš vidi u Bosni i Sandžaku.

Jedna od tipicnih srpski laži je ta da su hrvatski muslimani iz Bosne i Sandžaka poturice. To genetika ne dokaziva, ali dokaziva da su današnji Srbi u njihovoj genetskoj strukturi 49% Anadolci (Turci). Znaći da su Srbi pravoslavni Turci.


Gornji uspored gnetike Hrvata i Srba pokazuje da je nemoguča tvrdnja Srba da su Hrvati nastali od Srba. To je kao da tvrde da ke pas nastao od mačke.

A da se ne spominje da je hrvatsko ime prvi puta do 12.700 prije Krista u indisjskim Vedama (kasnije i Avesti, Bibliji i Kuranu) kao pisanim tragovima. Arheloški se Hrvati mogu dokazati prema iranskim arhelolozima u današnjem Iranu i Afghanistanu 3750 prije Krista.

Srbi se tek negdje prije 1100 godina spominju.

Ali ipak oni to i dalje tvrde. Dali iz manjka inteligencije ili iz drugi razloga se ne znade.


Možda najbolje srpski akademik D. Ćosić može objasniti razlog, koji o svojim Srbima kaže :

- „Mi lažemo da bismo obmanuli sebe, da utešimo drugoga; lažemo iz samilosti, lažemo iz stida, da ohrabrimo, da sakrijemo svoju bedu, lažemo zbog poštenja.
Lažemo zbog slobode.
Laž je vid srpskog patriotizma i potvrda naše urođene inteligencije.
Lažemo stvaralački, maštovito, inventivno.“

- „Laž je srpski državni interes.“
- „Laž je u samom biću Srbina“.
- „U ovoj zemlji svaka laž na kraju postaje istina.“
- „Srbe je toliko puta u istoriji spašavala laž…“

Ima i A. G. Matoš nešto o Srbima reći : “Srbima je laž od Boga.”

U Finskoj se i dan danas kaže : “Lažes kao Srbin”.

Crnogorac dr. Sekula Drljević kaže o takozvanim Srbima : "Nitko ne umije tako podvaliti kao što to može Srbin."

Srpska predsjednica Helsinškog odbora Srbije Sonja Biserko kaže : "Cijela srpska povijest je laž!"

U Hrvatskoj i odcijepljenim teritorijama je poznata izreka : “Nema nitko
što Srbin imade, pogotovo kad od Hrvata jezik, povijest i teritorije ukrade!”


Niti u jednom svetom spisu što tvrdi drugi čudni srpski "povjestničar" Rade Novaković se ne može naći niti spomena o Srbima. Najstariji povijesni spomeni o Srbima se pojavljuju tek negdje prije oko 1.000 god., a arheološki najstariji pisani nalaz hrvatskog imena je star oko 7.500 god. Hrvatsko ime se spominje u svim svetim spisima : Vede, Aveste, Biblija (Stari zavjet) i Kuran.

Arheloški se Hrvati mogu dokazati prema iranskim arhelolozima u današnjem Iranu i Afghanistanu 3750 prije Krista.

Hrvati imaju originalan jedinstven genetski marker koji čini oko 70-80% njihove genetske strukture u njihovom matičnom geografskom području (Dinarsko planinsko područje). Hrvatima su genetski bliski Tirenci (Sardinija), neki narodi s Kakvkaza (npr. Gruzini), dio Iranaca, Paštuni u Afganistanu, Siki iz Indije, a u Europi Nijemci,  Danci i Ukrajinci.

Kod Srba je dominantan tzv. altajsko-anatolski [ turski ] gen (oko 49%) te su  genetski bliski Turcima, Grcima, Rumunjima, Bugarima i imaju samo 5% hrvatskog gena, dočim imaju 16% afričkog gena (Hrvati samo 1%) i jedini u Europi sačuvane elemente afričke kulture (Strauli).  Najdublji srpski povijesni tragovi (stariji od 1.000 god) mogu se naći jedino u Somaliji na rogu Afrike gdje i danas žive dva ljudožderska plemena : SERBON I GEĐŽA.

Hrvatski gen je relativno rijedak i proteže se (kao i hrvatska kultura) od Hrvatske do sjeverozapadne Indije (preko Irana, Kavkaza, Afganistana) i točno pokriva “put znanja” koji je Stjepan Krizin Sakač (osnivač i prvi direktor Orijentološkog Instituta pri Sv.Stolici u Vatikanu) nazvao : “ZLATNI LANAC”.

Riječ Hrvat je izvedena iz riječi Harawat što na samskritu znači “božji narod” (hara = unutrašnja božja energija, wat = pleme, klan, bratstvo).

Prema Tarabićima riječ Srbin znači “rob Sotone” – onaj tko je okrenuo lice od Boga i vezan je isključivo za materijalnu stvarnost i „međusvijet“ magije, duhova i demona. U hermetici se ne pišu vokali (po Tarabićima), pa se riječ Srbin piše Srb, gdje jedino logičan vokal u „isčitavanju“ riječi jeste „o“ – Srob = „S“ simbol sotone + rob. Dobrica Ćosić najveći srpski nacionalist kaže da je temelj srpskog identiteta laž. Kršćanska misao kaže da je sotona otac svih laži.

Trebali još što dokazivati?


Međunarodni imperijalistički krugovi silom hoće „izčupati“ korijenje našeg narodnog stabla i uništiti našu vlastitu vrlo osebujnu kulturu. Dobro znaju da drvo bez korijena ne raste. Bez obzira kako se netko politički identificirao (nacionalno, vjerski, regionalno) trebao bi bar malo poznavati vlastitu povijest i temeljne civilizacijske principe. Sve tzv. slavenske države (osim Bugarske i moskovske Rusije) su nastale na temeljima starohrvatske kulture (Majorov, Kroch). Dakle, svi ti narodi dobrim dijelom baštine i hrvatsku kulturu koja predstavlja i njihovo korijenje.

Sa Srbima je teško tako razgovarati jer žive u mitovima i glorifikaciji nečega kao što smo i mi sami upoznali u novijoj povijesti,..ali da pređemo znanstveno, … .

Pismo pape Ivana VIII. knezu Branimiru izvanredno je važno jer predstavlja prvi dokaz postojanja hrvatske nezavisnosti u srednjovjekovlju.

879. godine datirano je znamenito pismo pape Ivana VIII. knezu Branimiru, jedan od najvažnijih dokumenata u čitavoj hrvatskoj povijesti. Naime, iz tog se pisma može zaključiti da je Branimir bio neovisan vladar, što je prvi dokaz postojanja hrvatske neovisnosti u srednjovjekovlju.

Papino pismo napisano je na latinskom jeziku, a započinje riječima: „Dilecto filio Branimir“ (Ljubljenom sinu Branimiru). Pismo je izrazito srdačno sročeno, a sadrži i obavijest o tome da je papa prilikom službe na oltaru sv. Petra dižući ruke uvis blagoslovio kneza Branimira, cijeli njegov narod te cijelu njegovu zemlju.

Nakon zapisa postoje nove znanstvene metode koje točno određuju postojanje nekog naroda na nekom prostoru,….znam za Srbe je to teško jer s tim ispitivanjima je dokazano da Srbi u biti su Hrvati, njihovu žalost !……Teško da oni mogu to prihvatiti, ali ja nisam izmislio ovu metodu koja se naziva HAPLOGRUPE ,.. koje su svi znanstvenici svijeta prihvatili kao jedina točna.



SRPSKI geneticari koji su potvrdili 49% turski haplotipa u takozvanoj “srpskoj” krvi :

Dr. Sanja Glišić i dr. Dragan Alavantić iz Instituta Vinča biokemijski su potvrdili kod Srba 49% altajsko-anatolski marker HG-2.

Institut za nuklearne nauke „Vinča“
p.fah 522
11001 Beograd, Srbija
Tel. : +381 11 3408 101 ; +381 11 3408 102

Laboratorija za radiobiologiju i molekularnu genetiku
Tel. : +381 11 3408 686
Faks: +381 11 6447485


- Laboratory for Radiobiology and Molecular Genetics, Institute of Nuclear Sciences “Vinca,” Belgrade;
- Department of Genetics, University of Leicester, Leicester;
- CRC Chromosome Molecular Biology Group, Department of Biochemistry, and 3Institute of Molecular Medicine, University of Oxford, Oxford;
- Institute of General and Molecular Pathology, University of Tartu and Estonian Biocentre, Tartu, Estonia;
- IPATIMUP and Faculdade de Cięncias, Universidade do Porto, Porto, Portugal;
- Department of Zoology, University of Cambridge, Cambridge;
- Centro de Investigacion y Criminalistica, Laboratorio de ADN, Policia Judicial, Guardia Civil, and Laboratorio de Biología Forense, Departamento de Toxicología y Legislación Sanitaria, Universidad Complutense, Madrid;
- Dipartimento di Biologia, Universita di Ferrara, Ferrara, Italy;
- Umeĺ University, Department of Medical Genetics, Umeĺ, Sweden;
- Unitat de Biologia Evolutiva, Facultat de Ciecies de la Salut I de la Vida, Universitat Pompeu Fabra, Barcelona;
- Department of Genetics, Trinity College, Dublin;
- University of Oslo, Centre for Biotechnology, Oslo;
- Instituto Nacional de Saúde Dr. Ricardo Jorge, Lisbon;
- Forensic Laboratory for DNA Research, MGC-Department of Human and Clinical Genetics, Leiden University Medical Center, Leiden, The Netherlands;
- Laboratory for Forensic Genetics and Molecular Archaeology, Center for Human Genetics, K.U. Leuven, Leuven, Belgium;
- Research Centre for Medical Genetics, Russian Academy of Medical Sciences, UFA Science Centre, Department of Biochemistry and Cytochemistry, Moscow;
- Department of Physiology, University of Kiel, Kiel;
- Department of Medical Genetics, Institute of Endocrinology, Medical University of Lódz, Lódz, Poland;
- Department of Human Biology, Edith Cowan University, Joondalup Campus, and Western Australian Institute for Medical Research, Royal Perth Hospital, Perth;
- Genetic Research Laboratory, Institute of Legal Medicine, Medical Faculty (Charité), Humboldt-University Berlin, Berlin;
- Institute of Molecular Biology and Genetics, National Academy of Science of Ukraine, Kiev; - Department of Medical Biology and Genetics, Medical Academy of Latvia, Riga;
- Center of Human Genetics, University of Vilnius, Vilnius, Lithuania;
- Department of Biology, University of Rome “Tor Vergata,” Rome;
- The Cyprus Institute of Neurology and Genetics, Nicosia;
- Unité d'Immunogénétique Humaine, Institut Pasteur, Paris;
- Department of Medical Genetics, Kinderpoliklinik, Munich;
- La Trobe University, School of Genetics and Human Variation, Bundoora, Australia
- Department of Human Genetics, Memorial Sloan-Kettering Cancer Center, New York;
- Laboratory of Biological Anthropology, Institute of Forensic Medicine, University of Copenhagen, Copenhagen;
- Division of Medical Genetics, Department of Obstetrics and Gynaecology, Ljubljana, Slovenia;
- Dipartimento di Medicina Legale e Sanita Pubblica, Pavia, Italy;
- I.C. Biologice, Iasi, Romania; and Bogazici University, Department of Molecular Biology and Genetics, Istanbul;
- Dr. Mark A. Jobling, Department of Genetics, University of Leicester, University Road, Leicester LE1 7RH, United Kingdom;
- McDonald Institute for Archaeological Research, University of Cambridge, Cambridge;
- Department of Genetics, University of Leicester, Leicester, United Kingdom;
- Max Planck Institute for Evolutionary Anthropology, Department of Evolutionary Genetics, Leipzig;
- Departamento de Biologia Geral, Instituto Cięncias Biológicas/Universidade Federal de Minas Gerais, Minas Gerais, Brazil.

Konkretno, temeljni izvor za spoznaje o kojima govorim su radovi Zoe H. Rossera i čak 87 koautora iz 2000. godine, što je objavljeno u American Journal of Human Genetics broj 67 na stranicama 1526-1543, kao i spoznaje skupine znanstvenika objavljene u časopisu Science 2000. godine te njvečoj genetskoj bazi www, iz Kanade. Zatim, na temelju radova P. A. Underhilla iz 2001. godine, kao i drugih autora i izvora koji se bave otkrićima genetike. Od hrvatskih autora tim se otkrićima bavi dr. Primorac kao genetičar, a kao povjesničar Andrija-Željko Lovrić i drugi.





Hrvati nisu južni Slaveni :

Genetika je dokazala da su se narodi kroz povijest jako miješali, ali su ipak ostali dominantni markeri. Gdje smo se mi to u povijesti susreli s današnjim Nijemcima još nije jasno, kao i to zašto mi Hrvati imamo samo 10 posto prakeltskog faktora, a Nijemci čak 38 posto hrvatskog dinarskog faktora? Zanimljivo je da niti Srbi nisu južni Slaveni, već spadaju u skupinu Sibiraca. S druge strane, Mađari, za koje se to nikad ne bi reklo prema kulturi, su genetički Slaveni.

Na tribini Matice hrvatske Čakovec nedavnom je gostovao prof. dr. Ivan Biondić iz Zagreba. Tema tribine bila je: "Etnogeneza Hrvata : između znanosti i ideologije". U svojem je izlaganju dr. Biondić, a na temelju otkrića biogenetike izrekao mnogo toga što je u direktnoj suprotnosti s našim uobičajenim spoznajama o porijeklu Hrvata. To je i razlog što što smo ga zamolili da pojasni što je to u najnovije vrijeme otkrila genetička znanost.

- Možete li ukratko sažeti što to donose nove spoznaje uz pomoć biogenetike o porijeklu Hrvata?

- Biogenetika je doista u zadnjih nekoliko godina otkrila mnogo toga što zapanjuje i nas znanstvenike. Ukratko, biogenetika, a to znači stroga znanstvena istraživanja koja se mogu provjeravati, dokazala su da Hrvati nisu Južni Slaveni! Ta će spoznaja tek za godinu ili dvije doći do ušiju svih kojih se to tiče. Drugim riječima, ako vam sad neki profesor ili nastavnik ili akademik kaže da su Hrvati Južni Slaveni, možete ga slobodno optužiti da je rasist. Probajte, naime, na primjer Njemcima reći da su recimo Rusi, ili recite Francuzima da su recimo Šveđani, pa ćete vidjeti što će vam odgovoriti. Iz istog razloga ne može se više tvrditi da su Hrvati južni Slaveni, kao što to piše u svim udžbenicima naše povijesti i u Hrvatskoj enciklopediji.

- Na čemu temeljite takve spoznaje?

- Konkretno, temeljni izvor za spoznaje o kojima govorim su radovi Zoe H. Rossera i čak 87 koautora iz 2000. godine, što je objavljeno u American Journal of Human Genetics broj 67 na stranicama 1526-1543, kao i spoznaje skupine znanstvenika objavljene u časopisu Science 2000. godine. Zatim, na temelju radova P. A. Underhilla iz 2001. godine, kao i drugih autora i izvora koji se bave otkrićima genetike. Od hrvatskih autora tim se otkrićima bavi dr. Primorac kao genetičar, a kao povjesničar Andrija-Željko Lovrić i drugi.

- Što je genetika otkrila kad je riječ o Hrvatima?

- Prema genskoj tablici biokemijske srodnosti 47 europskih naroda ono što upada u oči je to, da je gotovo svaka skupina odnosno ono što zovemo narod tijekom povijesti pomiješana sa drugim skupinama. Ovdje dakako ne govorim o kulturama, nego o genetici, konkretnije o takozvanim "markerima" u genetici, kojima su ustanovljene razlike među narodima.

Kad je riječ o Hrvatima, znanstveno je dokazano da Hrvati nisu Slaveni sa 71 posto, a da takozvanog slavenskog faktora odnosno markera EU-19, kojim se to utvrđuje, imaju samo 29 posto.

- Što su na kraju Hrvati?

- Prema genetičkim istraživanjima, Hrvati imaju čak 45 posto takozvanog genetskog markera Eu-7 koji je nazvan Dinarskim, oni su naime posebna skupina među europskim narodima. Zatim, imaju 10 posto prakeltske "krvi" odnosno markera koji je karakterističan za Kelte odnosno Prakelte (Eu-18), 2 posto markera HG-2, koji je nazvan sibirskim faktorom, 2 posto markera Eu-16 koji je nazvan avarskim faktorom. Hrvati također imaju 7 posto biokemijske srodnosti s Hamitima (faktor Eu-4), te 5 posto faktora HG-9, koji označava Semite.

- S kojim su narodima ili skupinom naroda Hrvati najsrodniji, ako se može tako reći?

- Na to genetika daje zanimljiv odgovor. Kako su Hrvati posebna skupina ili imaju svoj genetski marker Eu-7 kojega od svih naroda imaju najviše, može se pitati koji narodi imaju isti genetski marker i u kojem postotku.

Najviše srodnosti s Hrvatima, odnosno najviše takozvanog dinarskog markera Eu-7, što je za neke začuđujuće, imaju Nijemci, čak 38 posto, s tim da kod njih s 50 posto dominira prakeltski marker. Prema postotku, srodnost s Hrvatima pokazuju dalje : Laponci s 32 posto, Nizozemci s 22 posto, Poljaci s 21 posto, Albanci s 20 posto, Makedonci s 19 posto, Francuzi sa 17 posto, Ukrajinci sa 17 posto, Englezi sa 16 posto, Mađari s 11 posto, a srodnost s ostalim narodima je manja od 10 posto.

Ovdje dakako ne treba zaboraviti da Hrvati imaju 29 posto slavenskog markera, ali on nije dominantan, već 71 postotni neslavenski markeri s dominatnim Eu-7.

- Hrvatska historiografija i jezikoslovlje godinama i desetljećima govori o srodnosti Hrvata i Srba, barem su nas tako učili u školi. Koliko smo genetski srodni sa Srbima?

Prema istim istraživanjima dokazano je da su Srbi narod koji ima 84 posto neslavenskog i 16 posto slavenskog faktora. Od 84 posto neslavenskog faktora, njihov je dominantan faktor HG-2 s čak 49 posto, što je oznaka za sibirsku skupinu naroda. U tu skupinu naroda spadaju na primjer : Srbi, Bugari, Gruzijci, Gotlandi i Šveđani, a u njima srodnu podskupinu i američki indijanci, te Turci. Označavaju ih genski markeri HG-2, Eu-21 i Eu-22. To zapravo znači da niti Srbima ne smijemo reći da su Južni Slaveni.

- Koji narodi spadaju u izvorne Slavene?

- U Europi su izvorni Slaveni (marker Eu-19) samo Rusi, Ukrajinci, Poljaci, Česi, ali sad slijedi iznenađenje, Letonci, Mađari i Kirgizi. Mađari imaju čak 60 posto slavenskog markera, što ih je tako pogodilo da su obavili više istraživanja da potvrde rezultate jer su bili, blago je reći, iznenađeni. No uvijek bi dobili isti rezultat.

- Prema genetskom stablu čovječanstva iz Y kromosoma, gdje bi se po povijesnom nizu svrstali Hrvati?

- Znanost je definitivno dokazala je su ljudi odonosno hominidi, a govorimo o Homo sapiensu, potekli iz Afrike. Direktni potomci Homo sapiensa su pak današnji Bušmani odnosno Pigmeji u ravnoj liniji. Za nas je zanimljiva velika grana stabla koja se opet dijeli na Negroide (crne Afrikance) te neimenovanu granu. Ta neimenovana grana stabla zatim se dijeli na dvije grane od kojih je jedna grupa Pacific, a druga nema naziva. Ta manja grana bez naziva dijeli se pak na Euroazijce i Jafetide. Jafetidi se pak dijele na Semite i Praindoeuropljane, koji se pak granaju na Vedoarijce i Dinaroide. Dinaroidi su, rekli smo već, Hrvati-Dinarci.

Germani imaju 38 posto hrvatskog markera iako su oni dominantno Prakelti, ali ih zbog visokog postotka možemo svrstati u ovdje, te Rusini iz Galicije, a zanimljivo je i Tirenci iz Sardinije i Korzike. Gdje smo se mi to u povijesti susreli s današnjim Nijemcima još nije jasno, kao i to zašto mi Hrvati imamo 10 posto prakeltskog faktora, a Nijemci 38 posto hrvatskog dinarskog faktora.

U nama blisku skupinu koje zajedničkim imenom zovemo Vedoarijci, s kojom dijelimo zajedničko praindoevropsko porijeklo, spadaju narodi kao što su Gruzini na Kavkazu, narodi sjeveroistočnog Irana, Tadjikistana, Baludjistana i narodi jugozapadne Indije. Kao posebna skupina Vedoarijaca su u direktnoj liniji i Romi odnosno Cigani.

Zanimljivo je da bi se Slavonce odnosno Hrvate iz sjevernih krajeva po istom istraživanju moglo svrstati u skupinu Baltoslavena koji s Prakeltima dijele svoje porijeklo koje se zajednički naziva : Europeidi. Ti bi Hrvati bili srodniji sa Slovencima, Česima, Ukrajincima, Rusima, ukratko Slavenima.

- Da se nakon genetičke vratimo kulturnoj povijesti. Takozvano "iransko" porijeklo Hrvata često je zanemarivano ili se o njemu govorilo s podsmjehom?

- Genetika nas je uvjerila da Hrvati-Dinarci dominantno nisu Slaveni već da dolaze od Praindoeuropljana, da je dakle takozvana iranska hipoteza koja je do sada najčešće bila prešućivana, imala svoje duboke temelje. To je ovih dana utvrdila tek genetika. Ovo naravno nipošto ne znači da su Hrvati najsrodniji današnjim Irancima, već je tu samo riječ o takozvanoj "iranskoj" hipotezi u znanosti.

(2016 su iranski genetičari objavili genetsku strukturu glavnog grada Teherana. 55% stanovnika su imali iransku genetiku, ali 45% stanovnika nisu. Iranski genetičari su ustanovili da tih 45% stanovnika imaju istu genetiku kao Hrvati. To prvo znaći da genetski Hrvata ima samo u Teheranu i okolici oko 9 miliona - od ukupno 20 miliona stanovnika. Drugo da Hrvati nisu genetski Iranci. Prema iranskim povjestničarima su Hrvati na današnjem podrucju Irana i Afganistana već tamo živjeli kad su stari Perzijanci (Iranci) kasnije došli na isto područje.)

U Hrvatskoj nitko nije vjerovao u tu iransku hipotezu. Primjera radi, kad su ruski carski arheolozi otkopali Tanajske ploče koje potječu iz 2. i 3. stoljeća naše ere i na kojima se spominje ima Hrvat, to tadašnju Jugoslavensku akademiju znanosti i umjetnosti u Zagrebu nije zanimalo.

Knjiga ruskog arheologa stajala je u JAZU; današnja HAZU, neraspakirana (nerazrezanih stranica) gotovo 100 godina! Tek prije nekoliko godina ta je knjiga u HAZU pročitana! No zato su otvorene sve knjige koje su nas uvjeravale da smo južni Slaveni, a politika je u tom smjeru pogreškom stvorila hrvatsko-srpski jezik. Mi čak 100 godina nismo imali niti slike Tanajskih ploča. Prvi Hrvat koji je dodirnuo te ploče prije desetak godina, koje se čuvaju u ruskom muzeju, je veleposlanik Hido Biščević. Nakon toga napravili smo gipsane odljeve koji dugo nisu imali mjesta u HAZU, da bi se tek nedavno dogodilo da budu ipak postavljeni na ulazu HAZU. Otkrivanjem Tanajskih ploča, uspostavlja se nova paradigma etnogeneze Hrvata, naspram ideološke jezično-slavenske, koja će umnogome promijeniti sliku o nama. Hrvati su zapravo narod koji je u korijenu Europe, odnosno mogu se smatrati kao jedan od najstarijih europskih naroda, koji o tome ima i kamene dokaze.

Promijenit će sliku i iznutra, više ćemo tragati za svojim korijenima, pa bi ponovno trebali postati interesantni kajkavski i čakavski. Stručnjaci kažu da se najviše staroga sačuvalo u nekim varijantama kajkavskog jezika, tako na primjer u bednjanskom kajkavskom izgovoru u Hrvatskom Zagorju. Naravno, nitko ne može tražiti da svi sad govorimo bednjanski kajkavski ili inačicama istarskog, koji također ima dosta starina, no to je dobro znati za budućnost jezika. Jer, jezik se mijenja i važno je u kojem pravcu ide.

Godinama su nas uvjeravali da su hrvatski i srpski jedan jezik. Danas je svima očito da su to dva jezika, s tim da je hrvatski štokavski standard umjetni jezik nastao zbog političke situacije. Drugim riječima, zaboravili smo svoj jezik i pitanje je hoćemo li ga ikad vratiti. Ono što možemo vratiti je smjer, važno je znati da su i kajkavski i čakavski bitniji za hrvatski standard nego se to do sada mislilo, da je to naša važna baština i kulturna povijest. Jedno od pitanja na tu temu koje će brzo uslijediti je i ovo : ako u školama učimo engleski ili mrtvi latinski te umjetno stvoreni književni standard, zašto ne učimo svoj maternji jezik, kajkavski ili čakavski?

Na kraju mogu reći da je genetika otvorila možda i više pitanja nego što je za sada dala odgovora, ali će sve to skupa izazvati revoluciju u društvenim znanostima. Promatrajte što će se sve zbiti u svijesti samo za godinu ili dvije, pa će biti jasnija dalekosežnost promjena.



U srbijanskom “Kuriru” 25. lipnja 2011. objavljen je članak pod naslovom :

“Kanađani tvrde : Bošnjaci i Crnogorci su Hrvati”

Nedavna istraživanja u genetskom laboratoriju u Vancoveru u Kanadi potvrdila su podrijetlo Bošnjaka i Crnogoraca. Genetska biblioteka sa stotinama tisuća genetskih uzoraka iz cieloga svieta ( objavili su svoja istraživanja iz Vancouvera, gdje se laboratorij i nalazi, u vezi Haplogrupe koja je direktno povezana s Bošnjacima i Crnogorcima.

Haplogrupa 1, koja se uzdigla prije odprilike 25.000 godina na Balkanskom poluotoku za vrieme posljednjeg ledenog doba, ekskluzivno je povezana s hrvatskom populacijom. Po prvi put u ljudskoj povijesti, u mogućnosti smo odkriti svoju povijest s 100 postotnom preciznošću tako što se oslanjamo na redoslied DNA koda koji postoji u svakom živom biću na našoj planeti.

Haplogrupe su DNA markeri koji su često geografski orijentirani i koriste se za praćenje zajedničkih predaka čitave populacije. Ovi markeri su često još više podjeljeni, dodatnim slovom ili brojem koji simbolizira još dublju pukotinu među ljudima. Na primjer, Hrvati i Bošnjaci imaju najvišu frekvenciju Haplogrupe 12a2, a to je marker koji se može pronaći samo unutar granica Hrvatske, Bosne i Hercegovine i malo više od pola Crne Gore.

Odkad su se pojavila istraživanja može se predložiti da su Bošnjaci i većina Crnogoraca po svim genetičkim podatcima - etnički Hrvati. Mapa pokazuje genetički marker 12a2 ograničen na Hrvatsku (32 posto), Bosnu (40 -50 posto), na ostok Hvar (66 posto), Korčulu (52 posto), Brač (36 posto) i Krk (95 posto). Odemo li sjeverno (prema Sloveniji) vidimo da marker nestaje i postaje slabiji. Isti fenomen nastaje i ako pogledamo prema Ulcinju, lociranom u Crnoj Gori, te ako pogledamo u Albaniju i Srbiju.

Prije 25.000 godina Haplpogrupa 1 pojavila se iz Haplogrupe 1J, zajedničkog predka Haplogrupe 1 i Haplogrupe J. Haplogrupa 1 smatra se ekskluzivnim hrvatskim markerom prema i autoru Dr. Ivanu Juriću, koji je u svojoj knjizi „Genetičko podrijetlo Hrvata" napisao da bi se marker 12a2 trebao zvati „Hrvatski marker". Jurić objašnjava da je Haplogrupa samo Hrvatska, a ne i Bošnjačka, jer dolazi iz današnje Hrvatske i širila se iztočno, prema Bosni, i južno prema Crnoj Gori, čineći obje zemlje sličnima.

Haplogrupa 1J došla je iz Haplogrupe F, te je mutirala u Haplogrupu 1 u današnjoj Hrvatskoj (predpostavlja se da je nastala na području oko grada Splita). Haplogrupa F nastala je u Africi prije odprilike 50.000 godina i širila se sjeverno, prema Bliskom istoku, mutirala i promienila se u 1J, popraćena nastankom Haplogrupe 1 u Hrvatskoj, prenosi

Treba li Bošnjake smatrati Hrvatima? To je za neke političko pitanje, a ne naučno. Nauka ne zna za barijere koje su postavile političke institucije. Genetski rečeno, Hrvati i Bošnjaci su neprimjetni. Oni, zajedno s polovinom populacije Crne Gore (do Ulcinja) su isti ljudi. Genetički, jedan narod, ali kulturno? To je drugo poglavlje i nije vezano za nauku.

Prema genetici, neki Bošnjaci imaju više hrvatskih markera nego neki Hrvati iz Hrvatske.

Kako je to moguće? Još jednom, nauka ne vidi kulturu ili nacionalnost. Ona vidi samo genetski kod, star tisuće godina. Najbolji odgovor je da su ti individualci koji nose Haplogrupu 12a2 markera, jednostavno etnički Hrvati. Na primjer kada bi bio jedan samo prozvani Bošnjak, ali imao velik postotak 12a2 Haplotipa, on bi bio etnički Hrvatski Bošnjak. Crnogorac, koji bi imao isti rezultat, bi bio etnički Hrvatski Crnogorac. Želimo istaknuti da je nacionalnost osobe (Bošnjak, Crnogorac, itd) osobna deklaracija i osjećaj, ali etnički raspored određen je genetičkim faktorom na kojeg osobna deklaracija ne može utjecati.

Tako Srbi pišu u “Kuriru”.


Pažnja : Srbi su izbrisali stranicu kad su shvatili šta su napisali ! Ubacite ovaj link original stranice : u ovu stranicu : pa opet možete vidjeti original stranicu!


Za Hrvate koji makar malo poznaju povijest, pa bili oni po vjeri kršćani, muslimani ili bilo što drugo, ovo nije nikakva novost.

Svi, pa tako i Srbi, uvijek su znali da su do dolazka Turaka 1463., Hercegovina i Bosna bile čisto hrvatske zemlje i da je do toga doba njihovo stanovništvo bilo je 99% hrvatsko.

Da ne ulazim u detalje o tome što se sve događalo u 400 godina turske vladavine u ovim hrvatskim krajevima, jer o tome smo već u nekoliko navrata govorili, dosta je napomenuti da se useljavanjem Vlaha i drugih nomadskih plemena s iztoka kroz ta 4 stoljeća turske okupacije demografska slika Hercegovine i Bosne stalno mijenjala na štetu domicilnog hrvatskog stanovništva.

Turci vrše silan pritisak na katoličku vjeru domaćeg pučanstva pa, iako postupno, mnogi primiše “tursku viru”, ali ne i na tursku nacionalnost.

Skoro svi plemići i velika većina običnoga puka ostadoše vjerni svojoj hrvatskoj naciji sve do dolaska Tita i njegovih boljševika 1945., kad je svakog muslimana koji bi u Bosni i Hercegovini izjavio da je Hrvat oznaskratila za glavu. Onaj koji bi se iz bilo kojih razloga izjasnio da je Srbin bio je nagrađen.

Bosna i Hercegovina grcale su u krvi. Pod silnim velikosrbskim pritiscima Hrvati islamske vjere su se izjašnjavali, neopredjeljenima, Jugoslavenima, neki čak i Turcima a vrlo, vrlo rijetko Srbima.

I tako sve do 1974. kad je Tito za njih izmislio muslimansku naciju.

Ni to nije dobro zvučalo, pa su 1992. Alija Izetbegović, Haris Silajdžić, “Tunjo” Filipović, pukovnik Ozne Adil Zulfikarpašić, Mustafa Cerić i drugi, crveni i zeleni, islamisti izumili bošnjačku naciju.

Od tada ti novi “Bošnjaci” žive u nekoj vrsti alternativne stvarnosti koja je samo njima jasna.

Nu što je žalostno jest to da su eto i velikosrbi, nakon 175 godina ( od vremena Garašaninivog “Načertanija” ) prisiljeni priznati istinu, a naši “Bošnjaci”, nešto radi svoje vjerske pripadnosti, a najviše radi svoje neukosti, još to nisu kadri skužiti.

Nekadašnj Crveni Hrvati, današnji Crnogorci, su druga pjesma.

Oni su žrtve jedne specifične osobine jednog jedinog naroda na svijetu koji njih (Crnogorce) smatra Srbima za to što je u 13. stoljeću jedan njihov vlastelin, Hrvat katolik Stefan Nemanja zauzeo Rašku, postavio sebe najprije za velikog župana ( naziv koji je čisto hrvatski ), a kasnije (1166.) za kralja i od bizantinskih kmetova Rašana stvorio novu srbsku naciju.

Poznato je da Nemanja uobće nije radio na posrbljavanju ondašnjih Zetana. Nasilno posrbljavanje počelo je tek 1918. kad je Srbija izvršila “Anschluß” Crne Gore. Tad su, prema srbijanskom rezoniranju, svi Crnogorci morali biti Srbi, ako za ništa drugo, onda za to što se njihov “kralj” Čika Pera Kara-Đorđević oženio “Zorkom Crnogorkom”, kćerkom knjaza Nikole Petrovića, kojeg su njegov zet Pera i unuk Aca iztjerali iz njegove knjaževine.

Ukratko, uzprkos svim prošlim i sadašnjim osvajanjima pojedinih hrvatskih krajeva i raznim povijestnim i geografskim revizijama, Bosna, Hercegovina i veliki dio današnje Crne Gore, od stoljeća sedmog bile su čisto hrvatske zemlje, što svjedoče mnoge stare zemljovidne karte , koje nisu pravili hrvatski nego strani kartografi.

Ali, za mnogo toga što se s nama događalo u prošlosti, a posebno za ovo što nam se danas događa, krivi smo sami mi jer smo, kako netko davno reče, uvijek bili glupi vitezovi ili vitežki glupani.

Uvijek smo dobivali bitke, a gubili ratove. Ovoga puta smo izpali najveći glupani jer smo protiv vanjskog neprijatelja dobili i bitke i rat, ali smo zaboravili razčistiti račune s domaćim izdajnicima.

Da smo to učinili onda kad smo lako mogli, ne bi danas morali sanjati o izgradnji mostova preko kojih bi mogli nesmetano prelaziti iz jednoga dijela Hrvatske u drugi. Mostove preko čisto hrvatske zemlje, koju smo u prošlome ratu krvlju svojih sinova oslobodili od ortaka i gospodara ovih koji opet zajašili na vlast da nastave s uništenjem i ovoga jadnog ostatka ostataka Hrvatske.

Trebalo bi izpitati genetičku pripadnost takozvani hrvatskih Srba. Vjerujem da bi rezultat bio vrlo zanimljiv.

Profesor Filip Lukas o pitanju dinarske rase : „Po današnjem antropološkom ispitivanju dinarska rasa je zastupana u čistijoj formi u krajevima naseljenim pretežno Hrvatima."


Literatura :

- Ivan Jurić 2003 : Genetičko podrijetlo Hrvata. Vlastita naklada, Zagreb (2. izdanje: Slobodna Dalmacija, Split 2005).

- Ivan Jurić 2005 : On the Y Chromosome Haplotype of the First Farmers in the Historical Territory of Croatia and the Directions of Agricultural Diffusion in Europe, Agric. conspec. sci. 70/4: 121-126.

- Ivan Jurić 2007 : Genetičko podrijetlo šokačkih rodova na području Vinkovaca. Godišnjak ogranka Matice Hrvatske sv. 24, Vinkovci.

- Ivan Jurić 2011 : Genetika Hrvata. Zagreb (u tisku).

- Ivan Nasidze, Schadlich H., Stoneking M. 2003 : Haplotypes from the Caucasus, Turkey and Iran for nine Y-str loci. Forensic Sci. Int. 137: 85-93.

- Ivan Nasidze & al. (17 koautora), 2004: Mitochondrial DNA and Y-Chromosome variation in the Caucasus. Ann. Human Genet. 68: 205-221.

- Ivan Nasidze & al. 2005 : MtDNA and Y-Chromosome variation in Kurdish groups. Annals of Human Genetics, 69: 401-412.

- Mirabal S., Varljen T. & al. 2010 : Human Y-chromosome short tandem repeats, A tale of acculturation and migrations as mechanisms for the diffusion of agriculture in the Balkan Peninsula. Amer. Journal of Physic. Anthrop. 142/3: 380–390. doi:10.1002/ajpa.21235. PMID 20091845

- Kr. Rebala, A.I. Mikulich & al. (7 koautora) 2007 : Y-STR variation among Slavs, evidence for the Slavic homeland in the middle Dniepr basin. Journal Human Genet. Japan.

- Rootsi S. & al. 2004 : Phylogeography of Y-chromosome haplogroup I reveals distinct domains of prehistoric gene flow in Europe. Am. J. Hum. Genet. 75/1: 128–37. doi:10.1086/422196. PMC 1181996. PMID 15162323

- Barać L, Pericić M, Klarić IM, et al. (July 2003). "Y chromosomal heritage of Croatian population and its island isolates". Eur. J. Hum. Genet. 11 : 535–42. doi:10.1038/sj.ejhg.5200992. PMID 12825075

- Rootsi Siiri & al. 2004 : Phylogeography of Y-chromosome Haplogroup I reveals Distinct Domains of Prehistoric Gene Flow in Europe. Amer. Journal of Human Genet. 75/1: 128–137. doi:10.1086/422196. PMC 1181996. PMID 15162323.

- D. Marjanovic & al. 2005 : The peopling of modern Bosnia-Herzegovina (Y-chromosome haplogroups in the three main ethnic groups). Ann. Hum. Genet. 69/6: 757–763. PMID 16266413, doi:10.1111/j.1529-8817.2005.00190.x.

- Alexander Varzari 2006 : Population History of the Dniester-Carpathians, Evidence from Alu Insertion and Y-Chromosome Polymorphisms. Dissertation, Facul. Biol. Ludwig-Maximilians University, München.

- Tatiana Karafet & al. 2008 : New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. Genome Research, doi:10.1101/gr.7172008.

- Vincenza Battaglia & al. 2008 : Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe. European Journal of Human Genetics; doi: 10.1038/ejhg.2008.249.

- Ken Nordtvedt : "The Lichtenstein cave Ydna haplotypes show three from the new S23+(xM223) I2b* (ISOGG 2008) tree".







[ Dućan ] [ Sve teme ] [ Teritorij Nezavisne Države Hrvatske ] [ Tko je tko ] [ Vojska ] [ Filatelija ] [ Valuta ] [ Odlikovanja ] [ HOP ] [ HOS ] [ Genocid ] [ Krugoval ]

 Flag Counter

[ Narudžba ] [ Uvjeti pružanja usluge ] [ Poštarina ] [ Pravo na povlačenje ] [ Otisak ] [ Izjava o privatnosti ]

Ova stranica koristi kolačiće. Ako i dalje ostanete na ovoj stranici, prihvaćate našu upotrebu kolači?a.

Privatnost OK